... Abstract A. V. Dmitriev, A. V. Ivanov, A. R. Khokhlov, Numerical simulation of light propagation through a diffuser, Fundamentalnaya i prikladnaya matematika, vol. 15 (2009), no. 6, pp. ... In this article, the light propagation in a diffuser with optically soft inclusions is described with the help of the Fokker--Planck equation, i.e., a transfer equation with a diffusion term in the space of radiation propagation directions. ... 8, 9] , x1 , : 1 D = (3 - x1 ), 6 3 x1 = 2 d x( )cos sin . ...

Еще в разделе: (Показать все результаты (>15) - lizard.phys.msu.su/ )

• http://lizard.phys.msu.su/home/science/jap-06.pdf
• http://lizard.phys.msu.su/home/science/Dmitriev-Ivanov-Xoxlov-11-JMathSci-Diffuser.pdf
• http://lizard.phys.msu.su/home/science/redistr-sst99.pdf

... Strike-slip magmatic duplexes . ... During 1996-1998 we have carried out a complex field and laboratory study of particular class of the geological objects, which we named strike-slip magmatic duplexes (SSMD), in limits of the Eastern Urals, Central Kazakhstan and Kola-Karelia region. ... 2) We recovered within the Eastern Urals a series of geological objects identidied as SSMD of different age and of different deepness, and studied them in detail due to field investigations. ...

Еще в разделе: (Показать все результаты (>11) - sbmg.geol.msu.ru/ )

... The mo del is a directed dyadic acyclic graph. ... New vertexes are added one by one. The probability of this addition dep ends on the structure of existed graph. ... 4 (2 ) FIGURE 4: The probabilities of different variants to add a new vertex to the future in the step number 500. pij is the probability to add a new vertex to the outgoing external edges numbers i and j . Similarly, p is the probability to add a new vertex to the incoming external edges numbers and . ...

Еще в разделе: (Показать все результаты (>17) - temporology.bio.msu.ru/ )

• http://temporology.bio.msu.ru/EREPORTS/krugly_a-sequential-growth.pdf
• http://temporology.bio.msu.ru/EREPORTS/krugly_discrete-sequential.pdf
• http://temporology.bio.msu.ru/EREPORTS/korotaev_experimental.pdf

... THE TIME HAS COME FOR "THUNDER BOOKS" . ... You may have forgotten what a thunder book is, or maybe you didn't ever use that name. ... It is a handy reference to those things you need to know about soils and how they behave. ... Well, if you knew how to use them as pages in a thunder book it would surely be a good start, but you need something uniquely yours. ... It has always been my belief that the mission of a soil survey is to help people understand and wisely use soil resources. ... Good read. ...

Еще в разделе: (Показать все результаты (>2) - www.paleopedology.msu.ru/ )

CUDA Center of Excellence NVIDIA 22 « » ­ NVIDIA HPC Day. NVIDIA, , . Wen-mei W. Hwu (), , . 9:30 -- 10:00 10:00 -- 11:30 The Future of GPU computing Prof. Wen-mei W. Hwu 11:30 -- 12:00 Introducing Kepler: new generation GPU architecture Mark Ebersole , , 12:20 -- 13:20 , .. , .. , .. , .. 13:20 -- 15:00 GPU CUDA Prof. Wen-mei W. Hwu - « » : 2- , . 238 : http://ccoe.msu.ru

Еще в разделе: (Показать все результаты (>4) - ccoe.msu.ru/ )

• OpenACC: Вычисления на GPU с помощью простых директив | GPU Center of

ChangeLog for tanchiki # # Generated by Trac 0.12.5 # 04/11/16 23:02:23 Mon, 20 Dec 2010 05:15:19 GMT Peter Zotov <whitequark@тАж> [21:fe5df803d6c2] * tanchiki/body.py (modified) * tanchiki/controller.py (added) * tanchiki/game.py (modified) * tanchiki/user_controller.py (added) Split UserController and Controller classes. Mon, 20 Dec 2010 05:08:18 GMT Peter Zotov <whitequark@тАж> [20:ee776b889df7] * tanchiki/game.py (modified) Improve Game interface. ...

Еще в разделе: (Показать все результаты (>1388) - kodomo.cmm.msu.su/ )

• http://kodomo.cmm.msu.su/trac/cca/log/?format=changelog&rev=0865e29e319df9486ce64a2b5e28808a54c6ca12&stop_rev=99%3A33fea6b97cd3&limit=100&mode=stop_on_copy
• http://kodomo.cmm.msu.su/trac/cca/log/?format=changelog&rev=0865e29e319df9486ce64a2b5e28808a54c6ca12&stop_rev=b3fb9595fee7ccf4db04b4f448092fa94188ed82&limit=100&mode=stop_on_copy
• http://kodomo.cmm.msu.su/trac/cca/log/?format=changelog&rev=0865e29e319df9486ce64a2b5e28808a54c6ca12&stop_rev=33fea6b97cd34ca033da0bd43c72c37ae5967579&limit=100&mode=stop_on_copy

... opt/atlas/12.0.8/cmtsite/setup.sh -tag=<release>[,<mode>] # # projects # . opt / atlas / 12.0.8 / cmtsite /setup.sh -tag= project , release [, mode ] # # Report bugs to hn- atlas -releaseKitProblem@cern.ch , atlas -sw-installation@cern.ch . # set CMTSITE STANDALONE set SITEROOT / opt / atlas / 12.0.8 macro ATLAS_DIST_AREA ${ SITEROOT } # use optimised version by default apply_tag opt apply_tag setup apply_tag projectArea ...

Еще в разделе: (Показать все результаты (>2) - lhe.sinp.msu.ru/ )

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>9) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/megablast.out

The file a_news.php had been edited by : IP: 193.232.121.99 Time: 22.12.2008|12:28:34 This message had been generated by http://www.web2ftp.com On abuse issues, please contact abuse@web2ftp.com

210. The Laboratory of chemistry and physics of sensor and semiconductor materials |

211. Научная Сеть - Scientific Network

212. Science

213. International media readings :: Department of Journalism, M. V. Lomonosov

214. http://top.sinp.msu.ru/lev/cms5.ps

215. Список публикаций - А. Н. Козлова - Кафедра вычислительной механики

216. http://e-journal.spa.msu.ru/uploads/vestnik/2004/vipusk_4._sentjabr_2004_g./nekipelov.pdf

217. http://geophys.srcc.msu.ru/library/wind_stress.pdf

218. Air-Permeability Influence on Pressure Distribution Character

219. One of the informative characteristics of the reverse electron transport in the

220. RELEC Mission: Relativistic ELECtron Precipitation and TLE Study on-board Small