... 433-438 IMPRINTING ON NATIVE POND ODOUR IN THE POOL FROG, RANA LESSONAE CAM. ... To reveal the natural reaction of wild individuals of the pool frog to native pond water frogs (Group 1) were caught near their native pond at the end of metamorphosis, on stages 43-46 (Gosner, 1960), and were tested in a chamber 76 cm long, 12 cm wide and 15 cm high, made of white plastic and covered with a transparent glass. ... In tests wild frogs of Group 1 were offered native pond water paired with tap water. ...
[
Текст
]
Ссылки http://vertebrata.bio.msu.ru/Imprinting_on_native_pond_odour_in_the_pool_frog.pdf -- 123.4 Кб -- 08.02.2010 Похожие документы
ISSN 1560-3547, Regular and Chaotic Dynamics, 2015, Vol. ... The Dynamics and Control of a Spherical Robot with an Internal Omniwheel Platform Yury L. Karavaev1* and Alexander A. Kilin 1 2** M. T. Kalashnikov Izhevsk State Technical University, ul. ... The problem of control of spherical robot motion along an arbitrary tra jectory is solved within the framework of a kinematic mo del and a dynamic mo del. ... To describe the motion of a spherical robot, we consider three coordinate systems. ... Vol. ...
[
Текст
]
Ссылки http://ics.org.ru/upload/iblock/d2d/196-the-dynamics-and-control-of-a-spherical-robot-with-an-internal-omniwheel-platform_ru.pdf -- 1417.6 Кб -- 28.10.2015 Похожие документы
... Les programmes d?enseignement . ... La page principale > Les programmes d?enseignement > . S?minaires options d??t? . ... le russe des affaires; . ... Les tudiants liront et analyseront des chef-d oeuvres de la po sie russe du ХIХ ХХ mes si cles; ils mettront les spectacles en sc ne et participeront galement aux mini-spectalces fond s sur la base de ce qu ils ont lu. ... Vous apprendrez le vocabulaire professionnel et les structures grammaticales, les plus communes dans le russe d affaires. ...
RAPID COMMUNICATIONS PHYSICAL REVIEW A, VOLUME 62, 011802 R High-intensity pulsed source of space-time and polarization double-entangled photon pairs Yoon-Ho Kim,* Sergei P. Kulik, and Yanhua Shih Department of Physics, University of Maryland, Baltimore County, Baltimore, Maryland 21250 Received 4 April 2000; published 13 June 2000 Two spatially separated type-I nonlinear ... Two orthogonally oriented type-I BBO crystals are placed collinearly and pumped by 45° polarized femtosecond pulses. ...
... История курсов . ... close this panel . ... Выпускной класс . Старшие классы . Младшие классы . ... Прием на курсы . ... График мероприятий . ... Телефоны, адреса . График работы . ... Приветствуем вас на сайте Общеуниверситетских подготовительных курсов.љ ... Обращаясь на курсы через форму "Задать вопрос", будьте внимательны при написании своего электронного адреса.љ . ... Сайт общеуниверситетских . подготовительных курсовљ . ...
... О КАФЕДРЕ ? ... GENERAL INFORMATION ABOUT THE CHAIR . ... Кафедра ЮНЕСКО по изучению глобальных проблем и возникающих социальных и этических вызовов для больших городов и их населения на факультете глобальных процессов Московского государственного университета имени М.В. Ломоносова . ... Cоздание кафедры ЮНЕСКО на факультете глобальных процессов МГУ открыло новые возможности для научных исследований в области возникающих глобальных социальных и этических проблемљ и для их преподавания. ...
... Coordination of economic policies and convergence of economic performance are fundamental to the integration of national economies in the Community. ... When U.S. President Barack Obama enters his White House meeting with Israeli Prime Minister Benjamin Netanyahu on March 5 -- angling to dissuade Israel from attacking Iran's nuclear facilities -- there will be one seemingly mundane issue on his mind that he may be too uncomfortable to share with his guest: gasoline prices. ... 2004. ...
Laboratory of Microfluidics and Nanofluidics . Laboratory of Physical Chemistry of Modified Surfaces . ... Research . ... Laboratory of Micro- and Nanofluidics . ... Professor B.V.Derjaguin moved to the Laboratory with his research group as an Emeritus Professor. ... In 1993 Professor Olga I. Vinogradova took over the leadership of the Laboratory. In 2009 the Laboratory of Micro- and Nanofluidics was organized by Professor Olga I. Vinogradova at the Physics Department of the M.V.Lomonosov MSU. ...
Dynamo Theory and Earth's Magnetic Field Paul Demorest May 21, 2001 1 Intro duction The Earth's magnetic field belongs in that class of physical phenomena which are commonplace yet also very complex. ... 3 Single Disc Dynamo Before we dive into the mess of equations and approximations that describe how fluid motion and magnetic field interact, it is useful to demonstrate a very simple system which exhibits dynamo action. ... A system without fluid motion cannot support a magnetic field indefinitely. ...
[
Текст
]
Ссылки http://ocean.phys.msu.ru/courses/geo/lectures-addons/15/2001%20Demorest%2C%20Dynamo%20theory%20and%20Earth's%20magnetic%20field%20.pdf -- 266.6 Кб -- 07.12.2009 Похожие документы
... Настоящим выпуском антропологи МГУ объявляют о появлении нового издания 'Вестник Московского университета. Серия ХХIII. Антропология'. ... В продолжение традиций мы надеемся, что 2009 год станет годом обновления Музея антропологии Московского университета, который откроется в Старом здании на Моховой после ремонта и реконструкции. ... Балахонова Е.И. Африканские коллекции из Московского Публичного и Румянцевского музея в Музее антропологии МГУ. ... А.Л. Пурунджан (1947-2009) Открыть . ...
... Monoamidated conjugate 1 was loaded into the apoenzyme of horseradish peroxidase (HRP) to afford an electrochemically and catalytically active reconstituted enzyme Fc-HRP with remarkably altered substrate spe[a] Lo Gorton, [b] and Elisabeth CsЖregi [c] cificity. ... 35] Reconstitution of apo-HRP with ferrocene-modified hemin chloride 1: Apo-HRP was prepared according to an acidic methyl ethyl ketone procedure of Teale.[ ... The loading of 1 into apo-HRP is strongly supported by UV/Vis spectroscopy. ...
... Only by numerical simulation. ... moment T (K) Dipole moment (D) Experiment Other example: Diffusion constant 200 250 298 350 400 2.40 2.37 2.48 2.59 2.80 2.25 The Distribution functions: radial distribution function 1 g (r) = N t =1 j i N TS N pair ( r - rij ) The Distribution functions: radial distribution function CC def 2 Work mode computer related 1) · Perform simulation , create trajectory file · Calculate properties timestep by timestep 2) · Perform ...
The Day the World Changed Vocabulary Expressions I Task1. ... Nazi war criminals committed appalling atrocities during World War II. 2.debris a quality of being well known for evil, esp. morally wicked actions. After the bombing there was a lot of debris everywhere. 3.resolve an act of great evil, esp. cruelty, shocking, terrible. ... He didn't seem daunted by the difficulties facing him. 9.infamy smth that needs attention, consideration, service, being more important than anything else. ...
[
Текст
]
Ссылки http://www.eng.math.msu.su/download/The_Day_The_World_Changed_article_and_vocabulary.pdf -- 1103.7 Кб -- 02.10.2011 Похожие документы
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
Cassa depositi e prestiti spa Long-Term Instruments for financing Infrastructure Franco Bassanini Chairman of Cassa Depositi e Prestiti Institute of the Russian Academy of Sciences September 22, 2010, Moscow Cassa depositi e prestiti spa Global capitalism and short-termism · The short-termism that characterized recent global capitalism had negative effects on the ...
LUT Summer School: www.lut.fi/summerschool summerschool@lut.fi Guide for Student Advisers Greetings from your colleagues at Lappeenranta University of Technology! ... With the wide-ranging selection of courses on-offer during the LUT Summer School we aim to both challenge and inspire students. ... Lappeenranta and LUT Lappeenranta is located some 220 km northeast of Finland's capital, and about 230 km northwest of St. Petersburg, Russia. ... The fee will be given on the LUT Summer School web pages. ...
[
Текст
]
Ссылки http://www.phys.msu.ru/rus/about/structure/admin/OTDEL-FOREIGN/INVITATIONS/LUT_Summer_School_2013_staff.pdf -- 448.5 Кб -- 17.01.2013 Похожие документы
MATSYM - symbolic matrix processor . ... To use the program you will need a MAT file (liked CIR file: "User manual for CIRSYM program") of your system. ... In first string of MAT file enter any text you want to be the title of your system. ... Starting from string 2 (if is not comments - "*") enter the system element name, incident row and column and, optionally, its value. ... To generate a solution, run MATSYM.exe and enter "system_file_name.CIR" or click on the "ENTER" (in "MAT" case). ...
... Инструкция по работе с информационными ресурсами в ОРОКС . ... Основные разделы сервера: Выбор раздела сервера ------------------------------------ На первую страницу "ChemNet" ------------------------------------ Химический факультет МГУ ------------------------------------ Электронная библиотека по химии ------------------------------------ Базы данных и другие источники информации по химии ------------------------------------ Периодические издания по химии -- Вестник МГУ. ...