Particle Z= 1 Peak Flux in [part/(cm*2*s*sr*MeV/nucl)] Probability=0.900 Time Interval=2007.04-2007.96 Sum of month sunspot numbers W= 117.8 Model Parameter NN= 1.60 Mean SEP Number NSEP= 0.80

Еще в разделе: (Показать все результаты (>1282) - swx.sinp.msu.ru/ )

• http://swx.sinp.msu.ru/models/database/progdata/datas/100713141722/prog_out.txt
• http://swx.sinp.msu.ru/models/database/progdata/datas/100713150640/prog_out.txt
• http://swx.sinp.msu.ru/models/database/progdata/datas/100705070644/prog_out.txt

... О факультете . ... Master In Ecology . Master In Nanobiotechnology . ... Nanobiotechnology and Biophysics? is intended for prospective highly qualified professionals with in-depth knowledge in of modern biophysics, molecular biology and nanobiotechnology. ... The program is focused at problems of modern nanobiotechnology, biophysics and proteomics, and hence it consists of the two parts: lectures/seminars and laboratory work. ... Lectures / Practical . ... Биологический факультет МГУ . ...

Еще в разделе: (Показать все результаты (>5) - www.bio.msu.ru/ )

Welcome to the site of the Laboratory of Mathematical Models of Quantum Scattering Processes . ... It develops mathematical models of ionizing collisions in atomic, molecular, and condensed matter physics. Main areas of current research activity include single and multiple ionization by electron, ion, and photon impact, ionization processes in strong laser pulses, and laser-assisted ionizing collisions. ... Research | ... c) Laboratory of mathematical models of quantum scattering processes, 2012 . ...

Еще в разделе: (Показать все результаты (>2) - lmmqsp.sinp.msu.ru/ )

... A nonlinear model that describes the interaction of a rigid body with a medium and takes into account (based on experimental data on the motion of circular cylinders in water) the dependence of the arm of the force on the normalized angular velocity of the body and the dependence of the moment of the force on the angle of attack is constructed. ... The present paper is the next stage in the study of a moving rigid body interacting with the medium only by the flat front area (plate). ...

Еще в разделе: (Показать все результаты (>34) - shamolin2.imec.msu.ru/ )

• http://shamolin2.imec.msu.ru/art-102.pdf
• Mathematical Reviews

Публикации Аксенова С.М. Назад в каталог . ... 3 Аксенов С.М., Розенберг К.А., Расцветаева Р.К. Упорядочение катионов в октаэдрических позициях высокотитанового биотита // Сб. материалов Всероссийской молодежной научной конференции 'Минералы: строение, свойства, методы исследования'. 16-20 марта 2009. ... 2, С. 201-206. 9a Rastsvetaeva R.K., Aksenov S.M., Chukanov N.V. Crystal structure of the Mn analogue of raslakite, a new representative of the eudialyte group // Doklady Chemistry, 2010, Vol. ...

Еще в разделе: (Показать все результаты (>30) - cryst.geol.msu.ru/ )

• http://cryst.geol.msu.ru/courses/rost/
• http://cryst.geol.msu.ru/literature/lit_yakubovich.php
• http://cryst.geol.msu.ru/aspirants/asp1.pdf

MSU . ... Moscow State University Science Park is one of the first technology parks in Russia. The MSU Science Park was founded in accordance with the decision of Moscow State University s Academic Council: Record # 4 from 15 October 1990 . The founders of MSU Science Park were organizations such as M.W. Lomonosov Moscow State University and the Innovation Fund of the National Committee of Science and Technology, a division of the Ministry of Education and Science of the Russian Federation . ...

Еще в разделе: (Показать все результаты (>6) - www.sciencepark.ru/ )

• MSU Science Park - Projects & Partners

... List of complexes . List of structures of RNA-protein and DNA-protein complexes . ... Experimental method: all X-RAY DIFFRACTION SOLUTION NMR ELECTRON MICROSCOPY FIBER DIFFRACTION SOLUTION NMR; THEORETICAL MODEL SOLUTION NMR; SOLUTION SCATTERING . Kind: all rna dna hybrid . ... HYDROLASE/DNA . X-RAY DIFFRACTION . ... dna . ... RNA BINDING PROTEIN/RNA . ... rna . ... HYDROLASE/RNA/DNA . ... HYDROLASE/RNA . ... TRANSFERASE/RNA/DNA . ... TRANSFERASE/DNA/RNA . ... NPIDB team 2003 - 2016 . ...

Еще в разделе: (Показать все результаты (>6) - npidb.belozersky.msu.ru/ )

• NPIDB: Home

. Yu.A.Shokin . Accurate positions of variable stars in the western part of the Large Magellanic Cloud bar . (published in IBVS and SAI Proceedings ) . B.S.Vozdvijenski, N.P.Gorbatko, V.A.Yeliseev, G.V.Romanova . The results of the observations of the selected minor planets in Sternberg State Astronomical institute . (published in SAI Proceedings ) .

Еще в разделе: (Показать все результаты (>13) - astrometric.sai.msu.ru/ )

• Photos. Before 2003
• AMT articles
• standard of astronomical data, catalogs

Использование метода симультанного осаждения для удаления фосфатов при очистке сточных вод в процессе с активным илом. ... В предыдущих публикациях представлены результаты исследований в лабораторных и полупромышленных условиях, их целью являлось получение экспериментальных данных, при этом исследовалась схема удаления из сточной воды фосфора при одновременном использовании биологического процесса и осаждения с применением смеси FeCl[2]-FeCl[3]. ...

Еще в разделе: (Показать все результаты (>7) - ecoinformatica.srcc.msu.ru/ )

• http://ecoinformatica.srcc.msu.ru/print_html.php?keyword=&num_records=1&theme=6&subtheme=24&from=&ref_ind=0207000105
• http://ecoinformatica.srcc.msu.ru/print_html.php?keyword=&num_records=1&theme=7&subtheme=17&from=&ref_ind=0412002133

Souviens-toi , c'Иtait un jeudi Souviens-toi , on avait suivi Le chemin des amoureux C'Иtait il Иtait une fois nous deux Souviens-toi , c'Иtait le grand jour Le grand pas vers le grand amour C'Иtait encore mieux que Гa C'Иtait nous deux il Иtait une fois Un mТtel sur la route du port Un soir banal Deux clients, un veilleur qui s'endort Sur son journal Il ...

Еще в разделе: (Показать все результаты (>9) - optics.sinp.msu.ru/ )

• Zagedan

Tevelev, Arc. ... Region that transsected by 'Urseis '95' includes four principal recent morphological units: (1) Pre-Uralian foredeep (subsident margin of the East European platform), (2) mountain building of the Western and Central Urals (overprinted and uplifted platform margin ); (3) East Uralian Plateau , (topographically smoothed and relatively low-level collage of oceanic, island arc and microcontinental terraines); (4) western margin of the West Siberian ...

Еще в разделе: (Показать все результаты (>12) - sbmg.geol.msu.ru/ )

• Calendar Converter
• (title)
• Список элементов HTML

Prediction of physical properties of materials based only on their chemical composition has long been an intriguing task. ... The main interests of Prof. Lebedev 's group are physical properties of crystals exhibiting structural instability, in which different phase transitions (including the ferroelectric one) can appear. ... A.I. Lebedev. ... Physics of the Solid State 51 , 362 (2009) ; e-print arXiv:1305.0240 (2013) ; [local copy] . ... Physics of the Solid State 51 , 2324 (2009) ; [local copy] . ...

Еще в разделе: (Показать все результаты (>44) - scon155.phys.msu.su/ )

Psychology in Russia: State of the Art · 2009 CliniC al psyChology of Corporeality: prinCiples of Cultural-historiCal subjeC t analysis Valentina V. Nikolaeva, Galina A. Arina Lomonosov Moscow State University Moscow The psychology of corporeality is a new and intensively elaborated branch of science. ... The psychology of corporeality is methodologically ready to maintain the unique psychological instrument which is the syndromic analysis of psychological and psychosomatic phenomena. ...

Еще в разделе: (Показать все результаты (>136) - www.psy.msu.ru/ )

• http://www.psy.msu.ru/science/conference/khomskaya/2014/petrakova.pdf
• http://www.psy.msu.ru/science/conference/lomonosov/2011/lomonosov-2011-eng.pdf
• http://www.psy.msu.ru/science/psyrussia/2012/introduction.pdf

Вы посетили: conf_engl.html . ... International Algebraic Conference dedicated to 70th birthday of professor A.V. Mikhalev, Russia, Moscow, November 2010 . ... International Algebraic Conference dedicated to the 100-year anniversary of professor A.G. Kurosh, Russia, Moscow, May 2008 . ... 2nd International Conferences on Matrix Methods and Operator Equations, Russia, Moscow, July 2007 . ... staff/guterman/conf_engl.html.txt Последние изменения: 13.02.2013 11:26 (внешнее изменение) | ...

Еще в разделе: (Показать все результаты (>17) - halgebra.math.msu.su/ )

• staff:guterman:conf_rus.html | Кафедра высшей алгебры
• staff:guterman:inv_engl.html | Кафедра высшей алгебры

Data are provided with the intent that they are readily available for personal and public non-commercial use and may be reproduced, in part or in whole and by any means, without charge or further permission from IWSG. However, proper reference to contributors of original data to the database must be provided in all cases, and due diligence should be exercised in ensuring the accuracy of the materials reproduced . ... Bird species report. In : ARCTIC BIRDS breeding conditions survey . ...

Еще в разделе: (Показать все результаты (>2) - arctic.ss.msu.ru/ )

... The Noun). ... The Verb). The Finite Forms of The Verb). The Simple Forms of The Verb). The Simple Present Tense). The Simple Past Tense). ... The Perfect Forms of The Verb). ... The Non-finite Forms of The Verb). ... Auxiliary Verbs). Modal verbs). Contraction of verbs). Irregular Verbs). The Adjective). ... The Use of Adjectives). ... The Pronoun). ... The Article). ... The Use of Articles with Proper Nouns). The Use of Articles with Geographic Names). ...

Еще в разделе: (Показать все результаты (>83) - ffl.msu.ru/ )

• About Us
• Research
• Admissions

... About the park-museum "Kolomenskoye" Kolomenskoye is a nice park and a former royal estate situated several kilometers to the southeast of the city center of Moscow, on the ancient road leading to the ancient picturesque town of Kolomna (hence the name). ... The estate was one of the favourite places for Ivan the Terrible. ... In XVI-XVII centuries there develops a unique architectural ensemble, subordinated to the idea of ceremonial royal residence, which is of great artistic and historical value. ...

Еще в разделе: (Показать все результаты (>5) - math.phys.msu.ru/ )

• http://math.phys.msu.ru/data/283/Conference_Dinner_07_April.pdf
• Department of Mathematics, Faculty of Physics, Lomonosov MSU

... IM2, c (2222430 nt) initn: 382 init1: 382 opt : 402 Z-score: 427.8 bits : 96.2 E(75): 3.7e-20 banded Smith-Waterman score: 402; 64.1% identity (64.1% similar) in 234 nt overlap (68- 300 :1090800-1091033) 40 50 60 70 80 90 NC_000 TAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTC-CGT :: : ::: :::: :: :: :: :: AE0094 AAGAGCCCGGCTTTTGCCCGGTCTAAAACGCCGGGCGAATAAGCGGGGGGCAAGTCTGGT 1090770 1090780 1090790 1090800 1090810 1090820 100 110 120 130 140 150 ...

Еще в разделе: (Показать все результаты (>3) - mouse.genebee.msu.ru/ )

e-mail: aup@socio.msu.ru) .. , . e-mail: vid@socio.msu.ru) .. , . e-mail: eka-dobrenkova@yandex.ru) , , , , , , social problem, political preference, taking part in elections, legitimating, confidence in state institutions and political leaders, protest moods , . ... It is revealing whom Russian citizen give political preference on the threshold of elections to the State Duma and the President RF, attitude to taking part in elections and expectation of changes after elections. ...

Еще в разделе: (Показать все результаты (>9) - vestnik.socio.msu.ru/ )

• http://www.socio.msu.ru/vestnik/archive/2010/4/04.pdf
• http://www.socio.msu.ru/vestnik/archive/2012/3/09.pdf
• http://www.socio.msu.ru/vestnik/archive/2013/1/16.pdf

The Early Music Theatre >> Repertoire >> Carmina Profanae . ... It is based on Karl Orff's cantata "Carmina Burana" and songs of 13th-century vagrants. ... The performance includes all the 25 parts of Orff's cantata "Carmina Burana" in Latin, old-Bavarian, and Russian (translations by M. Gasparov and L. Ginsburg) as well as authentic songs of 12-13th-century vagrants from "Carmina Burana" collection: "In taberna quando sumus", "Ecce gratum", "Tempus est iocundum". ...

Еще в разделе: (Показать все результаты (>4) - www.tsm-msu.ru/ )

• The Early Music Theatre -- The Prophetess (The History of Dioclesian)
• Life of wonderful Mr. Handel