THE LABORATORY OF CHEMISTRY AND PHYSICS OF SENSOR AND SEMICONDUCTOR MATERIALS . ... Nanocrystalline materials based on metal oxides for the detection of toxic and hazardous gases in the air. ... sensorovEst material group hopes that the new materials developed at the Faculty of Chemical laboratory "Chemistry and physics of semiconductor and sensor materials " will substantially increase the artificial olfaction. ... Acetone Sensing by Modified SnO 2 Nanocrystalline Sensor Materials. ...
Space Weather . ... Space weather . ... Data . ... You should fill in "Workspace" by groups of data sets to create plots. ... Putting different kind of data into the same plot remember, that the first dropped data set chooses and determines the axis scale for all data. ... If you need both kind of scale in the same plot, create two different plots and unite them. The speed of this service depends on 3 components: data processing on server, data transmission and data plotting in your browser. ...
MSU . Science Park . ... Prototyping center . ... Nowadays MSU Science Park provides office and laboratory premises in the center of Moscow in the close vicinity to the best University in Russia. ... One hundred twenty technological (IT, industrial engineering, medical devices and oil&gas services) companies are the residents of the Science Park. ... Five companies resident in MSU Science Park were listed amongst the top 50 by TechUspekh in their rating of the Top 100 innovative Russian companies. ...
Physics + Uspekhi 44 (6) 597 + 616 (2001) REVIEWS OF TOPICAL PROBLEMS #2001 Uspekhi Fizicheskikh Nauk, Russian Academy of Sciences PACS numbers: 03.65.Bz, 03.65.Ud, 03.65.Yz, 03.67. + a, 32.80.Qk Entangled quantum states of atomic systems I V Bargatin, B A Grishanin, V N Zadkov DOI: 10.1070/PU2001v044n06ABEH000940 Contents 1. Introduction 2. Theory of entangled states 3. Applications of entangled states 4. Entangled states of ions 2.1 Quantum correlations; 2.2 Pure entangles states; 2.3 Multipartite
... C. Gibbons, M. Locke: Cupid and Death - Third Entry . К. Гиббонс, М. Локк: Купидон и Смерть - Явление третье . Second Entry . ... Fourth Entry >> . ... Third Entry . ... Enter Chamberlain . Входит Прикащик . The Scene Chamberlain . ... Сцена Прикащик . ... Enter Host . ... Host . ... Chamberlain . ... Настоящий перевод текста маски Гиббонса и Локка Купидон и Смерть публикуется на условиях лицензии Creative Commons Attribution-NonCommercial-ShareAlike 3.0 Непортированная . ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
Some aspects of engineering solutions of ozonizer and ozone sensor. .. , . ... 30000 . ... Air cooling for ozonizer is always simpler and cheaper than water cooling. ... On the other hand it demands good adhesion between dielectric enamel and aluminium radiator. ... Discharge from needle allows generate ozone from non prepared air, but its efficiency is small. ... It is very reasonably to install little compressor in ozone sensor, which allows to inhale air probes from any narrow places. ...
[
Текст
]
Ссылки http://www.kge.msu.ru/ozone/archives/1rus_conf_pr/Presentations/Vorokhobov.pdf -- 273.5 Кб -- 29.08.2005 Похожие документы
... 32, No. 8, pp. 592603. i Central Regions of the Early-Type Galaxies in the NGC 3169 Group O. K. Sil'chenko1* and V. L. Afanasiev 1 2 Sternberg Astronomical Institute, Universitetskii pr. ... The mean age of the stellar populations in the centers of all three galaxies has been found to be approximately the same, 1 Gyr. ... In contrast, in NGC 3166, there is a metallicity gradient, but the stellar age remains approximately constant up to a distance of 8 from the center. ...
... N 1 Contents Buzhilova A.P. Anthropology at the Moscow University (to the 90 anniversary of Institute of Anthropology of the Moscow State University) (p. 4) Review. Historical development of the main trends in scientific research of the Institute and Museum of Anthropology, Lomonosov Moscow State University, is discussed. ... The article discusses the formation and development of ethnic anthropology in the Research Institute of Anthropology, Lomonosov Moscow State University from 1922 onwards. ...
[
Текст
]
Ссылки http://www.antropos.msu.ru/vestnic/e2013_1.doc -- 61.5 Кб -- 23.07.2015
[
Текст
]
Ссылки http://www.anthropos.msu.ru/vestnic/e2013_1.doc -- 61.5 Кб -- 23.07.2015 Похожие документы
МГУ имени М.В.Ломоносова Русская версия . ... Science calendar . ... World Politics . ... Associate professor, Deputy Dean for scientific research, Faculty of World Politics, Candidate of historical science . ... Associate Professor, the Department of Regional Problems of World Politics, Candidate of historical science . ... Naumkin Vitaly V. - Corresponding Member of the Russian Academy of Sciences, Professor, Head of the Department Regional Issues of World Politics, Doctor of historical science . ...
... Coordination of economic policies and convergence of economic performance are fundamental to the integration of national economies in the Community. ... When U.S. President Barack Obama enters his White House meeting with Israeli Prime Minister Benjamin Netanyahu on March 5 -- angling to dissuade Israel from attacking Iran's nuclear facilities -- there will be one seemingly mundane issue on his mind that he may be too uncomfortable to share with his guest: gasoline prices. ... 2004. ...
... Control of the Self Assembly Processes in a Droplet of a Colloidal Solution by an Acoustic Field O. V. Rudenkoa, P. V. Lebedev Stepanovb, V. A. Guseva, A. I. Korobova, B. A. Korshaka, N. I. Odinaa, M. Yu. ... The self assembly in the course of solvent evapora tion occurs owing to capillary forces, which displace the particles in the near surface layers of the solution as the volume of the latter decreases. ... For simplicity, we replace the actual droplet on a solid substrate by a plane liquid layer...
[
Текст
]
Ссылки http://acoustics.phys.msu.su/teachers/gusev_files/nano2.pdf -- 674.7 Кб -- 07.11.2012
[
Текст
]
Ссылки http://acoustics.phys.msu.ru/teachers/gusev_files/nano2.pdf -- 674.7 Кб -- 07.11.2012 Похожие документы
... The philosophical consequences of synergetics, the interdisciplinary theory of evolution and self-organization of complex systems, are being drawn in the paper. ... Key words: complex systems, evolution, nonlinearity, pre-determination, self-organization, soft management, structure-attractors, synergetics 1. ... The spectra of possible, `allowed' structures correspond to sets of the eigenfunctions of the nonlinear equations describing the evolutionary processes in the complex system. ...
[
Текст
]
Ссылки http://www.students.chemport.ru/materials/Philosophy/orph.pdf -- 61.0 Кб -- 15.01.2009 Похожие документы
... Gating mechanisms of a natural anion channelrhodopsin. ... Anion channelrhodopsins (ACRs) are a class of light-gated channels recently identified in cryptophyte algae that provide unprecedented fast and powerful hyperpolarizing tools for optogenetics. ... The first mechanism, characterized by slow opening and fast closing of the channel, is regulated by Glu-68. ...
DESCRIPTION OF THE TIME PROFILES OF KEY GEOMAGNETIC AND SOLAR WIND PARAMETERS . Time profiles of key geomagnetic parameters ( Ap and Dst indices) are shown together with key parameters of the solar wind (velocity V , density n and temperature T ) and IMF ( B , Bx , By , Bz in GSM coordinate system). ... High time resolution data on the solar wind plasma is obtained from Wind experiment in 1997 and ACE experiment in 1998-2002 using ISTP data base . ...
... About Us . ... The Department of Spanish Language . ... According to the information stated above, Spanish language department students are trained in the following areas: . ... Also, the Department of Spanish Language is the only department where detailed studying of Spanish language peculiarities and linguistic ethnical consciousness in Spain and Latin America are provided, thanks to specialized courses and seminars, apart from language studying, at a student's choice during 8 semesters. ...
... 2 (1997) 147-157 PRINCIPAL TRENDS IN MODERN ECOLOGY AND ITS MATHEMATICAL TOOLS: AN ANALYSIS OF PUBLICATIONS* E. V. BUDILOVA, J. A. DROGALINA, A. T. TERIOK.HIN Department of Biology, Moscow State University, Moscow 119899 (Russia) E-mail: lenl@ATeriokhin.home.bio.msu.ru (Received March 12, 1997) The paper deals with a scientometric analysis of publications from the journals Ecology and Ecologia (Russia) based on the ... Keywords of group С are encountered in 17% and В in 11% of papers. ...
[
Текст
]
Ссылки http://ecology.genebee.msu.ru/3_SOTR/CV_Terekhin_publ/1997_Scientometrics.doc -- 332.0 Кб -- 16.03.2009 Похожие документы
... In the spring semester, 2009, Fundamentals of Nanotechnology an interfaculty course prepared by ERC was given to third-year students of Faculties of Physics, Chemistry, Biology, Mechanics and Mathematics, Materials Science, Bioengineering and Bioinformatics, Fundamental Medicine. ... Приглашение на осеннюю школу-конференцию по Органической электронике 21?26 сентября 2014 года . ... XIII конференция студентов и аспирантов Научно-образовательного Центра по физике и химии полимеров 29 ноября 2013 года ...
... Geography of World Economy . ... Recreational Geography and International Tourism . ... Physical Geography and Landscape Science . ... About Faculty . ... Research laboratories . ... Field stations . Faculty branches . ... Education . Undergraduate study . ... Type of field courses . ... Russians, that have an education at university level, are allowed to study on government-sponsored places. Foreigners can receive only rental education, they have to conclude a contract with the faculty. ...
Euro-Asian Astronomical Society . The International Astronomy Olympiad . ... On the basis of the present Founding Statutes the Coordinating Council of the International Astronomy Olympiad elaborated and if necessary replenishes the "Acting Statutes/Regulations on International Astronomy Olympiad of School Children" which are approved at the meeting of authorized representatives from the founding organizations and participating states held every year during the Olympic period . ...