... Department . ... Department of the Automation for Scientific Research (ASR) was founded in 1988 on the basis of research and teaching group of the Mathematical Physics Department (former Department of Computational Mathematics). ... Under his guidance the department performs wide spectrum of research in the field of computer simulation of complex systems and processes. ... https://cs.msu.ru/node/1707 . ... 2008?2016 ASR Department , CMC Faculty , Lomonosov MSU . ...
МГУ имени М.В.Ломоносова Русская версия . ... Science calendar . ... About Conference . ... Asian and African Studies . ... Art Criticism and History . ... Section Mathematics and mechanics . ... International Conference for Students and Young Scientists "Lomonosov" . ... 29 Feb 2016 . ... In April 2016 Lomonosov Moscow State University will hold the XXIII Lomonosov International Conference for Students and Young Scientists within the International scientific youth forum "Lomonosov-2016". ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... Fast Facts about the Faculty of Journalism . ... Academic Departments . ... Full-time programs . ... Partners . ... All partners . ... Attraction of international students, development of cooperation with foreign partner universities is one of the priorities for the Faculty of Journalism. ... Foreign citizens can enter the Faculty of Journalism on a contract basis according to specific rules. ... Faculty of Journalism provides foreign applicants with a standard visa invitation. ...
... The colleges had gathered a lot of experience in upbringing of young people. ... Keywords: historical anthropology, cultural history, daily city life, women's education, modernisation, school medicine, empress Maria's establishments, closed girls' colleges Strokina A.N., Butareva I.I. Ergonomics measurements of body schoolchildren (p. 30) The article presents the children's body size, intended for the construction of facilities and activities for communities associated with their use of spaces. ...
[
Текст
]
Ссылки http://www.antropos.msu.ru/vestnic/e2014_1.doc -- 68.5 Кб -- 23.07.2015
[
Текст
]
Ссылки http://www.anthropos.msu.ru/vestnic/e2014_1.doc -- 68.5 Кб -- 23.07.2015 Похожие документы
Development of new approaches to the analysis of ring shapes in organic molecules and the description of electronic distribution (atomic charges) and halogen bonding in the framework of forcefield model for rapid estimation of intra- and intermolecular interaction energies in molecular mechanics, molecular dynamics and docking methods . Forcefield is a model and a set of parameters for theoretical description of intra- and intermolecular interactions. ... 2016 Laboratory of Medicinal Chemistry ...
... Received 2007 August 31; in original form 2007 June 21 ABSTRACT A spinar is a quasi-equilibrium collapsing ob ject whose equilibrium is maintained by the balance of centrifugal and gravitational forces and whose evolution is determined by its magnetic field. ... SPINAR SCENARIO OF MAGNETO-ROTATIONAL COLLAPSE. ... Let m be the ratio of the magnetic energy of the core to its gravitational energy: Spinar Paradigm and Gamma Ray Bursts Central Engine 3 exceeds the momentum corresponding to escape...
[
Текст
]
Ссылки http://observ.pereplet.ru/images/evgeny/article/2007/MNRAS.pdf -- 895.1 Кб -- 01.11.2007 Похожие документы
... Siberian Lang . Minority languages of Siberia as our cultural heritage . ... The project ?Development of the web-site ?Minority languages of Siberia as our cultural heritage? (on the material of the languages of the basin Middle Yenisei and the Middle and the Upper Taz)? was realized at the Laboratory for Computational Lexicography, Research Computing Centre, Lomonosov Moscow State University, with financial support from Russian Foundation for the Humanities, grant 12-04-12049.љ ...
... Symposium expenses . ... Abstract submission . ... 14 European Symposium on . Gas Phase Electron Diffraction . ... The deadline for abstract submission is 20 April, 2011. The abstracts have to be sent to the Symposium web address: ed.mos2010@gmail.com . ... Arial font and single spacing should be used throughout. The title should be centered and set with 14-point bold font style. ... The main body of text should be fully justified and set in 12-point regular font style. ...
The Department of Talented Youth Affairs and Professional Orientation . ... From May 15 to June 15 (2014), the design centre ?Artplay? hosts ?Robot ball? which represents an International Meeting of Modern Robots (official website: balrobotov.ru ). ... In order to participate in the ?Robot Ball?, more than 40 robots arrived in Moscow from USA, France, Germany, UK, South Korea, Japan, Russia, Canada, etc. ... 2016 - The Department of Talented Youth Affairs and Professional Orientation ...
Optical Transport N etwork (OTN) Tutorial Disclaimer: This is a Tutorial. This is NOT a Recommendation! This tutorial has no standards significance. It is purely for educational purposes. In case of conflict between the material contained in the tutorial and the material of the relevant Recommendation the latter always prevails. This tutorial should NOT be used as a reference; only the relevant Recommendations can be referenced. Summary This document provides a tutorial for Optical Transport Network stand
[
Текст
]
Ссылки http://lvk.cs.msu.su/~bahmurov/course_advanced_networks/ITU_OTN_Tutorial.pdf -- 583.5 Кб -- 21.09.2015 Похожие документы
TUS/KLYPVE Program for Observation of Extreme Energy Cosmic Rays from Space B.A. Khrenov DV Skobeltsyn Institute of Nuclear Physics of MV Lomonosov Moscow State University Workshop "Cosmic Ray Large Scale Experiments in the Second Decade of the 21st Century" 17 May 2011 TUS/KLYPVE collaboration SINP MSU, JINR (Dubna), RSC "Energia", Consortium "Space Regatta" EWHA University (Seoul, Korea) Puebla University (Mexico) Universities of Japan, RIKEN (Tokyo). ... Digital oscilloscopes for UV flashes. ...
THE ROLE OF DEVELOPING NATION TOWARDS COMBATING THE CYBER CRIME Abhishek Vaish and Satya Prakash, Indian Institute of Information Technology, Allahabad. ... Highlights on the recent trends: A report of Indian computer Emergency Response Team (CERTIN) shows that more than 2500 incidents were registered and handled in the year 2008. ... Others security incidents reported in the year 2004 was 4, in the year 2005 was 18, in the year 2006 was 17, in the year 2007 was 264 and in the year 2008 was 94. ...
[
Текст
]
Ссылки http://www.iisi.msu.ru/UserFiles/File/bayern2010/vaish_ea.pdf -- 652.4 Кб -- 02.04.2012 Похожие документы
... He distributes these gifts in sacks (each sack can contain from 1 to n items) and puts the sacks with gifts around the Christmas tree (only the content of the sacks and their ordering on the circle around the tree are important). ... A river falling into a sea forms a delta which is a system of branches consisting of channels without inner intersections. (a) Suppose that in a given delta there are exactly n different (i.e. differing by at least one channel) routes down the stream. ...
... Scientific educational events were organized at the Chair and the Faculty in the framework of the All-Russian School RESEARCH AND EDUCATIONAL PROJECTS on Global Social and Natural Processes in Interdisciplinary AND ACTIVITIES Studies as a joint action with the MSU Youth Council on Federal Task Program aimed at the inclusion of young Scientific research studies done by students of people in the scientific educational innovation processes the Chair and the Faculty were praised at the in Russia. ...
[
Текст
]
Ссылки http://fgp.msu.ru/wp-content/uploads/2014/09/UNESCO_CHAIR-2.pdf -- 1261.4 Кб -- 13.09.2014 Похожие документы
Please enter the lightcurve file name and period search parameters: . Lightcurve file: . ... Apply the Heliocentric correction and convert all dates to Terrestrial Time (TT)? ... Also, the Heliocentric correction cannot be applied to such lightcurves. ... This period search service is also available at the mirror sites: Mirror 1 , Mirror 2 , Mirror 3 , Mirror 4 . You may download the latest source code distribution and install the period search service at your own web server. ...
... Наука >> Физика >> Основы технологии >> Квантовые вычисления | ... Написать комментарий . ... Специалисты в IBM построили квантовый компьютер . ... IBM анонсировала , что осуществлена первая работающая реализация алгоритма разложения числа на множители Шора (Shor's factoring algorithm). Используя свои разработки, специалисты в IBM построили квантовый компьютер с семью квантовыми битами. ... Этот компьютер успешно решил задачу по разложению числа 15 на множители, получив в результате 5 и 3. ...
Экологическая оценка воздействия агропромышленного комплекса на состояние малых рек Башкортостана Ecological estimation of agricultural complex influence of small rivers of Bashkortostan / Абдюкова Э.А., Кулагин А.Ю., Рашитова Г.С., Абдюкова Г.М. // Научный журнал КубГАУ, 2011. ... В статье дана оценка влияния агропромышленного комплекса на состояние малых водотоков. Проведены гидрохимические и микробиологические исследования рек в основные фазы водного режима. ... индикаторы, микроорганизмы . ...