... About CIE MSU . Academic Programmes . Admissions . ... Vestnik CIE (in Russian) . ... Homepage > Admissions > . Study Periods . 2014-2015 academic year . ... One academic year programme: . September 2014 - June 2015 . Arrival Dates . ... August 28 October 31 . June 2015 . One and a half academic year programme: . ... STUDY PROGRAMMES AND COURSE DATES . ... September 20 15 - June 20 16 . ... Study Period . ... Recommended Arrival Dates . ... June 2 6 June 29 . ...

Еще в разделе: (Показать все результаты (>30) - www.cie.ru/ )

• Center for International Education - News Archive
• Russian as a Foreign Language Testing :: Academic Programmes :: CIE

... The Council on Complex Problems of Cosmic Rays of the Russian Academy of Sciences and the Skobeltsyn Institute of Nuclear Physics (SINP) of Lomonosov Moscow State University are planning to held a workshop "Cosmic Ray Physics Large Scale Experiments at the Second Decade of the 21st Century" on May 16-18 2011 at the Moscow State University. ... The Workshop banquet will be held on Tuesday, May 17 th . ... Workshop тАЬCosmic Ray Physics Large Scale Experiments at the Second Decade of the 21st Century"...

Еще в разделе: (Показать все результаты (>6) - tunka.sinp.msu.ru/ )

Mathematical Modeling of Complex Information Processing Systems 119 OPTIMAL CONTROL IN THE PROBLEM OF UNPACKING A SPACE TELESCOPE MIRROR V. V. Alexandrov 1 , D. I. Bugrov 1 , B. A. Khrenov 2 , S. S. Migunov 1 , and L. Gomez Esparza 3 The problem of optimal control in the processes of unpacking a space telescope­detector is considered. ... The coordinate system Oxyz associated rigidly with the segments is obtained by the rotation of the system Ox 1 y 1 z 1 about the axis Oz 1 by an angle '. ...

Еще в разделе: (Показать все результаты (>92) - num-anal.srcc.msu.ru/ )

• http://num-anal.srcc.msu.su/eng_math/redict/6.htm
• http://num-anal.srcc.msu.su/eng_math/redict/8.htm
• http://num-anal.srcc.msu.su/eng_math/redict/18.htm

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>2) - mouse.genebee.msu.ru/ )

... Real environments where objects are settled down are non-uniform and they are the source of many physical problems of acoustical imaging. ... Two groups of methods of image reconstruction in non-uniform environments are considered, and the basic attention is given to nonlinear phase methods as unlike methods of the first group, wave front inversion by matched filtering processing, they do not require detailed knowledge of parameters of the non-uniform medium. ... Acoustics of non-uniform mediums. ...

Еще в разделе: (Показать все результаты (>49) - www.msm.biophys.msu.ru/ )

... X-COM: Distributed Computing Software . ... The idea of distributed computing, or metacomputing, is to combine available computational resources for different applications processing. ... For these applications we simultaneously used high-performance computational resources of Moscow State University and Russian Academy of Sciences, computing centers of Saint Petersburg, Novosibirsk, Chelyabinsk, Ufa, Tomsk, etc. ... Research Computing Center (RCC) of Lomonosov Moscow State University . ...

Еще в разделе: (Показать все результаты (>55) - hpc.msu.ru/ )

• MSU's HPC HISTORY | Moscow University Supercomputing Center
• APPLICATIONS: Geophysics | Moscow University Supercomputing Center
• APPLICATIONS: Plasma Physics | Moscow University Supercomputing Center

... О Школе . ... ВШБ МГУ - школе . ... Выпуски журнала . Выпуск 1/2009 Выпуск 1/2010 . Выпуск 2/2010 Выпуск 1/2011 Выпуск 2/2011 Выпуск 1/2012 Выпуск 2/2012 Выпуск 1/2/2013 Выпуск 1/2/2014 Рубрики журнала Информация для авторов Общая структура статьи Информация для рецензентов Контакты . ... Менеджмент Выпуски журнала Выпуск 1/2010 . ... Содержание выпуска 1/2010: . ... EFFECTIVE MANAGERS: THE SECRET TO THEIR SUCCESS FROM THE TEAM ROLES PERSPECTIVE . ... Среда бизнеса . ... Выпуск 2/2010 . ...

Еще в разделе: (Показать все результаты (>72) - www.mgubs.ru/ )

• Выпуск 2/2010 | Высшая школа бизнеса МГУ им. Ломоносова
• Выпуск 1/2012 | Высшая школа бизнеса МГУ им. Ломоносова
• Высшая школа бизнеса МГУ им. Ломоносова

О кафедре . ... Динамические задачи теории упругости . Динамика пластин и оболочек . ... Методы теории упругости . ... Нелинейная теория упругости . ... Пластины и оболочки . ... Теория и расчет оболочек тонкостенных летательных аппаратов . ... Теория упругости структурно-неоднородных тел . ... Уравнения изгиба пластин классическая линейная теория. ... Колебания пластин. ... Oscillation of plates . ... МГУ им. М.В.Ломоносова, механико-математический факультет, кафедра теории упругости . ...

Еще в разделе: (Показать все результаты (>3) - elast.math.msu.su/ )

... Заведующий лаборатории - профессор А.В. Немухин . ... IV Международный симпозиум "Topical Problems of Biophotonics", 21-27 июля , Нижний Новгород Приглашенный доклад: М.Г. Хренова , А.В. Немухин, А.П. Савицкий "Molecular modeling of the Forster resonance energy transfer between fluorescent proteins" . ... Конференция Biocatalysis-2013, 2-7 июля Москва Доклад: А.В. Немухин "Molecular mechanisms of the enzymatic hydrolysis reactions of nucleotide triphosphates" . ...

Еще в разделе: (Показать все результаты (>9) - lcc.chem.msu.ru/ )

The final deadline for pre-registration and abstract submission is 20 May 2002. ... Workshop Proceedings are available for download. 30 Sep 2002 . Information on Workshop Proceedings . 28 Aug 2002 . Venue of the Workshop . 12 Jul 2002 . Workshop program is available now! ... 24 May 2002 . Visas to Russia? ... Information on accomodation in Petropavlovsk. New topic "1952 Kamchatka tsunami" was added. ... Information . ... Tel: 7(095) 939-3698 Fax: 7(095) 124-8713 . ...

Еще в разделе: (Показать все результаты (>25) - seac47-2.phys.msu.ru/ )

• LOCAL TSUNAMI WARNING AND MITIGATION -- Official information

... Moscow: Russian Library of Foreign Literature, 2009, 351pp. ... Moscow: Languages of the Slavic culture, 2007 (792 pp.) ... In: Russian, Slavic and Indo-European Studies. ... In: Sopostavitel'noe izuchenije slovoobrazovanija slavjanskix jazykov (Comparative study of derivation in Slavic languages), Moscow, 1986, pp. 150-156 (in Russian). ... 1958-- "On the Relations between Slavic and Baltic Languages," (in collaboration with V. N. Toporov), 4th International Congress of Slavic Studies, Moscow. ...

Еще в разделе: (Показать все результаты (>15) - imk.msu.ru/ )

• Vyach. Vs. Ivanov. Institute of World Culture

... Course Name . ... Software Development for Computational Problems . ... Prof. Fedor S. Zaitsev . Data Analysis Methods . ... Computational Physics and Nanotechnology . ... Assoc. Prof. Igor N. Inovenkov . Mathematical Models for Dynamic Processes . ... Prof. Igor V. Zotov . ... One-Dimensional Problems of Mathematical Physics . ... Two-Dimensional Problems of Mathematical Physics . ... Maple for Mathematical Physics Problems . ... Source URL: http://ani.cs.msu.su/en/courses . ...

Еще в разделе: (Показать все результаты (>7) - ani.cs.msu.su/ )

• The ASR Department at the CMC Faculty of Lomonosov MSU

... 193.232.122.X 193.232.123.X 193.232.124.X 193.232.125.X 212.192.235.X 212.192.250.X 193.232.121.X 212.192.236.X ----------------> > > > > > > > 93.180.48.X 93.180.49.X 93.180.50.X 93.180.51.X 93.180.52.X 93.180.53.X 93.180.54.X 93.180.55.X , : Ip address: Subnet mask: Gateway: DNS server: 193.232.124.25 255.255.255.240 193.232.124.17 193.232.122.33 : Ip address: Subnet mask: Gateway: DNS server: 93.180.50.25 255.255.255.240 93.180.50.17 93.180.48.33 .. , ip-, dns- 3 ( , , ) 3. . ... 2-50 .1114 . ...

214. http://danp.sinp.msu.ru/LIIWM/JPhys_ConfSer194_8_082007_VAKho.pdf

215. International Office of Moscow University - Exchanges with Moscow University

216. School overview | MSU Higher school of management and innovation

217. MPH-CMC-MSU

218. Meeting with the first course

219. http://polly.phys.msu.ru/en/news/attach/2012-04-05-lectures-Farle.pdf

220. http://www.iisi.msu.ru/UserFiles/File/bayern2010/sadowsky.doc