. This page uses frames, but your browser doesn't support them.

Еще в разделе: (Показать все результаты (>13) - optics.sinp.msu.ru/ )

• ABOUT PARTICULARITIES OF INTENSITIES DISTRIBUTION IN CROSS-SECTION OF POWERFUL

. Показ слайдов для альбома :: 40-летие Филиала МГУ . Показ слайдов . Fullscreen applet [Современные браузеры] [Совместимые, но с ограничениями] . Галерея: Филиал МГУ в Дубне Альбом: 40-летие Филиала МГУ . If you don't have the Java Plugin 1.4 or later, or you don't want to wait for the applet to download, you can use one of the non-fullscreen versions. Your browser doesn't support applets; you should use one of the other slideshow methods. Powered by Gallery v1.4.3-RC3 .

Еще в разделе: (Показать все результаты (>6) - www.msu.dubna.ru/ )

• Показ слайдов для альбома :: Школы
• Показ слайдов для альбома :: ОИЯИ
• Показ слайдов для альбома :: В аудиториях филиала

The Shigeyoshi Matsumae Stadium in Moscow University was opened on September 1, 1989, on the campus of Moscow University, as the first full-scale stadium having artificial turf in the Soviet Union (at that time). ... The stadium was a gift by Tokai University to Moscow University, as the result of more than 20 years of exchange and friendship between Tokai University and Moscow University in exchanging students and teachers, as well as academic and cultural works since 1973. ...

Еще в разделе: (Показать все результаты (>8) - mguteam.chat.ru/ )

• Visiting on a work outs on our team
• About Work Outs on Our Team

... We will dwell on linguistic aspects and Lexical Resources of POLITEXT branch having in mind some intermediate semantic representation of a whole text as the basis for differentiated Information Extraction. It is personal data (in the social sphere) recognition in texts that we focus on, see (Leontyeva et al. ... As the main instrument of semantic analysis of coherent texts this dictionary bears the important information on how to build BTF-units starting from lexemes of SemDict entries. ...

Еще в разделе: (Показать все результаты (>4) - leontyeva.srcc.msu.ru/ )

• Semantic Dictionary for Text Understanding and Summarization

Published on Department of the Automation for Scientific Research CMC MSU ( http://ani.cmc.msu.ru ) . ... Alexander Valeryevich POZDNEEV (November 22, 1983, Novosibirsk, Russia) тАФ teaching assistant (assistant professor). Graduated with honours from the Faculty of Computational Mathematics and Cybernetics (CMC) at Lomonosov Moscow State University (MSU) (2006). Succesfully completed postgraduate study at the Faculty of CMC at Lomonosov MSU (2009). ... A.V. Pozdneev. ...

Еще в разделе: (Показать все результаты (>15) - ani.cmc.msu.ru/ )

• Alexander Valeryevich Pozdneev | Department of the Automation for Scientific
• The ASR Department at the CMC Faculty of Lomonosov MSU | Department of the
• Alexander Pozdneev at the ASMS 2008 Conference | Department of the Automation

Faculty of Physics, Lomonosov Moscow State University Advanced Quantum Field Theory: Mo dern Applications in HEP, Astro & Cond-Mat Instructor: O. Kharlanov Handout 2 (Spring 2015 term) 1. Within the theory of a free massless scalar D = 1 + 1, consider the operator 1 ^ : T00 : (f ) 2 : (t (x, 0))2 + (x (x, 0))2 : f (x)dx, ^ ^ where f (x) is a non-negative infinitely differentiable function with a compact support (a ^ ^ bump function ). ... T00 : (f ) | ...

Еще в разделе: (Показать все результаты (>11) - theorphys.phys.msu.ru/ )

All PostScript files are compressed by gzip. ... Carrier transport and non-equilibrium phenomena in doped PbTe and related materials. - physica status solidi (a), 1993, 137 , 9-55 ( PostScript file ) ( PDF file ). ... Physics Reports, 1995, 257 , 85-131 ( PostScript file ) ( PDF file ). ... Phys., 1999, 86 , No 6, 3241-3246 ( PostScript file ) ( PDF file ). ... 1999, 14 , No 9, 852-856 ( PostScript file ) ( PDF file ). ... Вестник МГУ, Сер. физ., 2000, в.1, 39-43 ( PostScript file ) ( PDF file ). ...

Еще в разделе: (Показать все результаты (>15) - lizard.phys.msu.su/ )

• http://lizard.phys.msu.su/home/science/redistr-sst99.pdf
• http://lizard.phys.msu.su/home/science/redistr-sst99.ps.gz

Welcome to ASC14 To whom it may concern With the supports from the High Performance Computing (HPC) experts and organizations, the ASC13 Student Supercomputer Challenge has concluded with great success. ... We are calling for registration and preliminary contest preparation. ... Some of them may finally take HPC as a career option, such as some students from National Defense University team have already contributed to the Tianhe-1A and Tianhe2. ... Award Overall Gold Winner: 100K RMB (~16000 USD) . ...

Еще в разделе: (Показать все результаты (>2) - smu.cmc.msu.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>6) - mouse.genebee.msu.ru/ )

• ConClus
• Nhunt: program for nucleic acid sequence similarity search

... Starting : grid-proxy-init or voms-proxy-init -voms atlas [photon] 1. ... Printing information on a VOMS proxy : voms-proxy-info -all 9. ... Obtaining information about computing resources : lcg-infosites --vo photon ce [about CE] lcg-infosites --vo photon se [about SE] lcg-infosites --vo photon all [about CE+SE] lcg-infosites --vo photon closeSE lcg-infosites --vo photon lfcLocal [local LFC servers] 13. lcg-info command : lcg-info --list-attrs [Get the list of supported attributes] 14. ...

Еще в разделе: (Показать все результаты (>11) - lhe.sinp.msu.ru/ )

• Brief CompHep Installation Instruction

Invited talk Session 1C-4, 17:50h Ultrafast magnetophotonics and magnetoplasmonics A.Yu. ... One of the most prominent opportunities of using SPP nanostructures is to shape femtosecond laser pulses. ... External magnetization of the magnetoplasmonic crystal induces temporal modulation of 200 fs laser pulses when the SPP resonance is tuned across the spectral range of the femtosecond pulse being used. ...

Еще в разделе: (Показать все результаты (>68) - nanolab.phys.msu.ru/ )

• http://nanolab.phys.msu.ru/sites/default/files/nl503029j3.pdf
• http://nanolab.phys.msu.ru/sites/default/files/jbo21_035001_2016.pdf
• http://nanolab.phys.msu.ru/sites/default/files/jmmm2015.pdf

... A p P EC Astropar ticle Physics for Europe Ї Cosmic rays: A large array for the detection of charged cosmic rays ( Auger North) Ї Gamma rays: A large array of Cherenkov Telescopes for detection of cosmic high energy gamma-rays ( CTA ) Ї High energy neutrinos: A cubic kilometre-scale neutrino telescope in the Mediterranean (KM3NeT) Ї Dark matter search: Ton-scale detectors ... A p P EC Astropar ticle Physics for Europe Ї Cosmic rays: ґ ґ ґ ґ ґ AMS detector launched. ...

Еще в разделе: (Показать все результаты (>7) - tunka.sinp.msu.ru/ )

... At present, SDSS (ugriz), UKIRT WFCAM (YJHK), ; Johnson-Cousins (UBVRcIc), and 2MASS (J2H2Ks2) ; are supported ; redshift - redfshift of a galaxy ( floating point) ; colour_name - colour identification (string) ; colour_value - value of colour in magnitudes ( floating point) ; should be in the AB mags for ugrizYJHK ; and in Vega mags for Johnson-Cousins/2MASS colours ; ; RETURN VALUE: K-correction in the specified filter for given redshift ; and ...

Еще в разделе: (Показать все результаты (>8) - kcor.sai.msu.ru/ )

• http://kcor.sai.msu.ru/calc_kcor.pro

... It operates with high efficiency inside a 1 T magnet in an intense charged particle beam of up to 3 в 106 particles/s. It uses a unique light collection system combining air space, wavelength shifter disc and conventional lucite light guides. ... Description of the counter The final CPVA counter is composed of a plastic scintillator, an air light guide, a wavelength shifter disc, lucite wave guides and two phototubes; their configuration and dimensions are given below. ... Optics of the CPVA counter...

Еще в разделе: (Показать все результаты (>65) - lav01.sinp.msu.ru/ )

• http://lav01.sinp.msu.ru/~vlk/LECT_2015_new/lect_10_2015_HBT-corr.pdf
• http://lav01.sinp.msu.ru/nir/papers/NIM_Cyl-Drift-Ch.pdf
• http://lav01.sinp.msu.ru/~igor/seminar/CorrFlow_In_AMPT_vlk.pdf

... ESA Space Weather Activities | ... Space Environments and Effects Analysis Section, | ... Introduction THE NATURAL SPACE ENVIRONMENT REPRESENTS A CONSIDERABLE HAZARD FOR SPACECRAFT AND THE EUROPEAN SPACE AGENCY (ESA) HAS FOR MANY YEARS TAKEN MEASURES TO ENSURE THAT ITS SPACECRAFT ARE ABLE TO SURVIVE AND OPERATE IN IT. ... 2.2 Radiation Effects As in other space agencies, ESA's concerns with space weather effects probably began with concerns over radiation effects on spacecraft systems. ... 2000). ...

Еще в разделе: (Показать все результаты (>125) - www.kosmofizika.ru/ )

• CREATION AND DESTRUCTION OF THE SOLAR PROTON BELTS IN THE INNER MAGNETOSPHERE
• Frequently Seen Space/Astronomy Acronyms
• X-RAY, GAMMA-RAY EMISSION AND HIGH-ENERGY CHARGED PARTICLES IN NEAR-EARTH-

... A new mechanism governing the dynamics of territory changing between groups of people such as countries is proposed based on trading with approval of both sides under particular voting rule (veto rule, majority rule, etc.) ... A state equation is obtained based on particular personal utility function. ... The countries which have approximately the same marginal 4 utility of the territory at the border would fight rather than trade as a result of equilibrium in the corresponding game. ...

Еще в разделе: (Показать все результаты (>9) - belyakov.imec.msu.ru/ )

. EX99_1.txt . EX99_2.txt . PER97V1.txt . PER99_2.txt

Еще в разделе: (Показать все результаты (>3) - al.cmc.msu.ru/ )

Apache2 Ubuntu Default Page . It works! This is the default welcome page used to test the correct operation of the Apache2 server after installation on Ubuntu systems. ... Ubuntu's Apache2 default configuration is different from the upstream default configuration, and split into several files optimized for interaction with Ubuntu tools. ... The configuration layout for an Apache2 web server installation on Ubuntu systems is as follows: /etc/apache2/ |-- apache2.conf | ... Document Roots . ...

219. EUROMECH Colloquium-458

220. http://shamolin2.imec.msu.ru/art-102.pdf