Заведующий кафедрой Head of the Chair . ... История кафедры . ... В 1966 г. для расширения ведущихся на кафедре научных работ в НИИ Ядерной физики МГУ был создан отдел физики плазмы (ОФП), в 1989 году переименованный в отдел микроэлектроники (ОМЭ). ... Сегодня по различным научным направлениям, ведущимся по специальностям, преподаваемым на кафедре атомной физики, физики плазмы и микроэлектроники, работает около 100 научных сотрудников, среди которых 12 докторов наук и около 50 кандидатов наук. ...

Еще в разделе: (Показать все результаты (>2) - www.affp.mics.msu.su/ )

... Юрий (admin) Новости история психологии , конфренции , методология и история психологии , психологические исследования No Comments . ... Юрий (admin) Новости big data , большие данные No Comments . Большие данные . ... Ноя 25 . ... Юрий (admin) Новости Кот Шредингера No Comments . ... Юрий (admin) Новости анализ и визуализация данных , видео , графика , презентации , статистика , Ханс Рослинг No Comments . ... Юрий (admin) Новости R , анализ данных , полезные советы , статистика No Comments . ...

Еще в разделе: (Показать все результаты (>19) - tukachev.flogiston.ru/ )

• Tag: e-mail
• Likert-Type Scale Response Anchors

RAPID COMMUNICATIONS PHYSICAL REVIEW A, VOLUME 62, 011802 R High-intensity pulsed source of space-time and polarization double-entangled photon pairs Yoon-Ho Kim,* Sergei P. Kulik, and Yanhua Shih Department of Physics, University of Maryland, Baltimore County, Baltimore, Maryland 21250 Received 4 April 2000; published 13 June 2000 Two spatially separated type-I nonlinear ... Two orthogonally oriented type-I BBO crystals are placed collinearly and pumped by 45° polarized femtosecond pulses. ...

Еще в разделе: (Показать все результаты (>119) - qi.phys.msu.ru/ )

• http://qi.phys.msu.su/papers/2006-jetp(e)-102-712.pdf
• http://qi.phys.msu.su/papers/2005-jetp(e)-100-521.pdf
• http://qi.phys.msu.su/papers/2007-jetp(e)-104-30.pdf

PHYSICAL REVIEW A 68, 022309 2003 Entangling quantum measurements and their properties B. A. Grishanin* and V. N. Zadkov International Laser Center and Department of Physics, M. V. Lomonosov Moscow State University, 119899 Moscow, Russia Received 20 December 2002; published 20 August 2003 We study the mathematical structure of superoperators describing quantum measurements, including the entangling measurement --the generalization of the standard quantum ...

Еще в разделе: (Показать все результаты (>78) - qilab.phys.msu.ru/ )

• http://qilab.phys.msu.ru/papers/PRA-2000-61-52305-en.pdf
• http://qilab.phys.msu.ru/papers/FortschrPhys-2000-en.pdf
• http://qilab.phys.msu.ru/papers/LasPhys-2000-10(6)-en.pdf

Space Weather . ... Space weather . ... Data . ... You should fill in "Workspace" by groups of data sets to create plots. ... Putting different kind of data into the same plot remember, that the first dropped data set chooses and determines the axis scale for all data. ... If you need both kind of scale in the same plot, create two different plots and unite them. The speed of this service depends on 3 components: data processing on server, data transmission and data plotting in your browser. ...

Еще в разделе: (Показать все результаты (>2428) - swx.sinp.msu.ru/ )

• SWX - Космическая погода

... Keywords: anthropology, craniotrigonometry, skull angular morphometry, the Russian Imperial Romanov family, shaping angles parameters Sviridov A.A. Cranial study of population of Loyalty Islands (Melanesia) (p. 88) The aim of this work is to study cranial series of 67 skulls from the Loyalty Islands (Northern Melanesia), stored at Musee de l'Homme (Paris, France). ... The study of intragroup variability showed a difference in the cranial types of the population of the Lifou and Mare islands. ...

Еще в разделе: (Показать все результаты (>49) - www.anthropos.msu.ru/ )

• http://www.antropos.msu.ru/vestnic/e2014_1.doc
• http://www.antropos.msu.ru/vestnic/e2013_1.doc
• http://www.antropos.msu.ru/vestnic/e2013_4.doc

Web of Science http://isiknowledge.com Web of Science , ( ) , . Web of Science. Search, Cited Reference Search Advanced Search, (Search History) (Marked List) 1. ... Science Citation Index Expanded (SCI-EXPANDED) ґ Social Sciences Citation Index (SSCI) ґ Arts & Humanities Citation Index (A&HCI) ґ . ... Marked List), . ... Analyse Results Create Citation Report. ... Cited Reference Search Web of Science , , / . Search (). ... Add to Marked List. Add to Marked List, , Marked List , . ...

Еще в разделе: (Показать все результаты (>6) - sinp.msu.ru/ )

• SINP MSU

Cell Biology International 27 (2003) 293ґ294 Cell Biology International www.elsevier.com/locate/jnlabr/ycbir Short communication Microtubule dynamics in living cells : direct analysis in the internal cytoplasm Ivan A. Vorobjev a a,* , Irina B. Alieva a, Ilya S. Grigoriev b, Gary G. Borisy c Laboratory of Cell Motility, A.N. Belozersky Institute, Moscow State University, Moscow, Russia b Department of ... These data demonstrate that MT growth is impeded at the cell margin. ...

Еще в разделе: (Показать все результаты (>33) - cellmotility.genebee.msu.ru/ )

... Electronic journal Issue 4. 10 september 2004 Leigh E. Making Learning a Game Introduction. As a university lecturer I enjoy playing games with learning goals in mind. My students are all adults who work in many different roles. ... Their needs include learning how to design activities that will support acquisition of practical skills, extend personal understanding of emotional factors, and improve awareness of factors ґ such as economic, ecological and political aspects of society. ... Play. ...

Еще в разделе: (Показать все результаты (>578) - e-journal.spa.msu.ru/ )

• http://e-journal.spa.msu.ru/uploads/vestnik/2004/vipusk_4._sentjabr_2004_g./ulrich.pdf
• http://e-journal.spa.msu.ru/uploads/vestnik/2004/vipusk_4._sentjabr_2004_g./vorontchuk.pdf
• http://e-journal.spa.msu.ru/uploads/vestnik/2004/vipusk_4._sentjabr_2004_g./paliulis_chlivickas.pdf

MOSCOW STATE UNIVERSITY -- Faculty of Biology -- Department of Human Physiology -- . ... Our interest is the secret springs of work of a brain. How can a new idea be born in the brain if the physical environment remains constant? ... What mechanisms of the brain are broken in schizophrenia? ... For this purpose we create brain-computer interfaces (BCI) based on modern methods of computational electroencephalography. ... Department of Human Physiology . ... Former Visitors . ... Former students . ...

Еще в разделе: (Показать все результаты (>63) - brain.bio.msu.ru/ )

• Change-points at different levels of the hierarchy of EEG segmental...
• At closing the Congress. (With the Chief)
• EEG feature extraction

Synthesis and Use of Humic Derivatives Covalently Bound to Silica Gel for Np(V) Sequestration I.V. Perminova , L.A. Karpiouk, N.S. Shcherbina*, S.A. Ponomarenkoї, St.N. Kalmykov, and K. Hatfield Department of Chemistry, Lomonosov Moscow State University, Moscow 119992, Russia Vernadsky Institute of Geochemistry and Analytical Chemistry, Russian Academy of Sciences, Moscow 119991, Russia ї Institute of Synthetic Polymer ... I.V. Perminova, et al. ...

Еще в разделе: (Показать все результаты (>178) - mgumus.chem.msu.ru/ )

• http://www.mgumus.chem.msu.ru/ihss/pdf/slovakia-2005.doc
• MGUMUS -- Third Conference of CIS IHSS on Humic Innovative Technologies Humic
• MGUMUS -- Second International Conference of CIS IHSS on Humic Innovative

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>8) - mouse.genebee.msu.ru/ )

Lomonosov Moscow State University FACULTY OF ARTS 2011 ALEXANDER LOBODANOV DEAN OF THE FACULTY OF ARTS Wxt? v?€€xtzтxс4 g{x Ytvт€рч ?y T?рс уx?x tvvxІрxw |° ... Since 2003 he has been chairman of the Department of Semiotics and the General Theory of History, founded by him, the first of its kind in Europe. ... Department of Semiotics and the General Theory of Arts The Department of Semiotics and the General Theory of Arts is a theoretical department. ... Galina Zadneprovskaya manages this department. ...

Еще в разделе: (Показать все результаты (>2) - arts.msu.ru/ )

Title Should Be in Bold, 18-Point Type and Centered, Please Use Title Case Author name(s) [10-point type, centered, bolded] Author affiliation and full address (8-point type, centered, italicized) Author e-mail address: (8-point type, centered, italicized) Abstract: Indent left and right margins 0.5 in. (1.27 cm), justify the paragraph (on both right and left), and use the same font as in the body of the paper. ... 5] Author(s), "Title of paper," in Title of Proceedings, Name(s), ed(s)., ...

Еще в разделе: (Показать все результаты (>10) - iconolat13.phys.msu.ru/ )

• Invited speakers
• Symposia
• Excursions

Wireshark Ї Ї Ї Ї Ї (Win, Mac, Linux) Open Source (http://www.wireshark.org) Ї Ї Ї ( ) Ї 2 1 Ї # usermod ґa ґG wireshark user Ї wireshark root user@host:~$telnet ya.ru 80 Trying 213.180.193.3.. ... MAC 2. MAC IP ARP 3. L4 Interface # 1 2 3 4 Domain # 1 1 Eth Address 00:00:00:00:00:0a 00:00:00:00:00:09 IPv4 Address 10.0.1.2 10.0.1.1 10.0.2.2 10.0.0.3 Flow # 1 2 Src Itf # 1:49153 3:49153 Dst Itf # 4:234 1:432 Protocol TCP UDP Edges 1-2 1-2 .. ...

Еще в разделе: (Показать все результаты (>8) - lvk.cs.msu.su/ )

• http://lvk.cs.msu.su/~sveta/lecture1_formal_methods.pdf

Cassa depositi e prestiti spa Long-Term Instruments for financing Infrastructure Franco Bassanini Chairman of Cassa Depositi e Prestiti Institute of the Russian Academy of Sciences September 22, 2010, Moscow Cassa depositi e prestiti spa Global capitalism and short-termism Ї The short-termism that characterized recent global capitalism had negative effects on the ...

Еще в разделе: (Показать все результаты (>14) - www.mse-msu.ru/ )

• http://www.mse-msu.ru/files/rossipr12.pdf
• http://www.mse-msu.ru/Nekipelov_France_2010_Slides_Eng.pdf

. Перейти к содержимому . Меню и виджеты . открыть | закрыть Найти: . +7 (495) 939-3038 . aislepkov physics.msu.ru . Ваш e-mail не будет опубликован. Обязательные поля помечены * . Имя * . E-mail * . Сайт . Комментарий . Можно использовать следующие HTML -теги и атрибуты: <a href="" title=""> <abbr title=""> <acronym title=""> <b> <blockquote cite=""> <cite> <code> <del datetime=""> <em> <i> <q cite=""> <strike> <strong> . Сайт работает на WordPress

Еще в разделе: (Показать все результаты (>2) - aislepkov.phys.msu.ru/ )

... MATHEMATICAL AND SYSTEM BIOLOGY UDC 577.1 Membrane Profile-Based Probabilistic Method for Predicting Transmembrane Segments via Multiple Protein Sequence Alignment R. A. Sutormina and A. A. Mironova a b , b, c State Research Center GosNIIgenetika, Moscow, 117545 Russia; e-mail: sutor_ra@mail ... Bioinformatics, Moscow State University, Moscow, 119992 Russia Received January 25, 2006 Abstract--Prediction of transmembrane (TM) segments of amino ... Protein Sci. ... Proteins. ...

Еще в разделе: (Показать все результаты (>11) - storage.bioinf.fbb.msu.ru/ )

News of PARALLEL.RU par-news на mail.parallel.ru . ... Следующее сообщение: PARALLEL.RU - Новости, специальный выпуск [17/11/2009] . ... Выпуск 275 . 10 ноября 2009 г. ------------- Российская академия наук и Суперкомпьютерный консорциум университетов России проводят 29 марта - 2 апреля 2010 года в Уфе IV Международную конференцию Параллельные вычислительные технологии (ПаВТ'2010). http ://agora.guru.ru/pavt ------------- НОВОСТИ МИРА ВЫСОКОПРОИЗВОДИТЕЛЬНЫХ ВЫЧИСЛЕНИЙ http :// parallel.ru / ...

Еще в разделе: (Показать все результаты (>153) - mail.parallel.ru/ )

• PARALLEL.RU - Новости, выпуск #288 [01/06/2010]
• PARALLEL.RU - Новости, выпуск #302 [15/02/2011]
• PARALLEL.RU - Новости, выпуск #284 [06/04/2010]

ВМиК-Online! ... Студенты . ... Выпускники . Работа . ... Компания HP создает новые возможности для того, чтобы технологии приносили максимальную пользу людям, компаниям, государственным структурам и обществу в целом. ... Бизнес HP в России уже 6 лет подряд показывает результаты лучше рынка ИТ в целом. ... Вакансии компании Hewlett-Packard: . ... Телефон компании HP: +7 (495) 797-35-00. ... МГУ . ... Рейтинг компаний составляется на основе данных Клуба выпускников МГУ . ... 2001 2012 ВМиК Online! ...

Еще в разделе: (Показать все результаты (>42) - www.cmc-online.ru/ )

• ВМиК - Online! : Работа для выпускников и студентов ВМК МГУ - Kelly Services
• ВМиК - Online! : Кафедра ММП
• ВМиК - Online! : Абитуриентам факультета ВМК МГУ - Варианты по английскому...