... Информационный портал о карьере и работе для студентов и выпускников технических и естественнонаучных специальностей . ... Ярмарка вакансий и стажировок для студентов и выпускников вузов . ... Management Information System (MIS) analyst, Junior systems analyst. Management Information System (MIS) analyst (reference code 'MIS') . Job profile: . Personal Installment Loans (PIL) & Credit Cards (CC) MIS development & maintenance . ... PIL & CC Ad-Hoc MIS Ideal candidate's profile: . ...
... Specialist degree . ... Master degree . ... Master variants . ... About Faculty . ... Mechmath faculty admission resumed its work and is actively preparing for the new reception 2015! ... Read more about Schedule in June . ... The Dean of Mechanics and Mathematics Faculty, the head of the Department of Mathematical and Computer Analysis Methods, professor Vladimir Chubarikov ; . ... Read more about The Open Day . ... 2016 Mechmath admission for internetional students ...
... My field of specialization is Stability Theory, Nonlinear Dynamics, Asymptotic Methods, Mechanics of Solids, System Identification, Optimal Control, Economic Growth. ... A.O. Belyakov and A.P. Seyranian (2012). ... A.O. Belyakov and A.P. Seyranian, . ... A.P. Seyranian and A.O. Belyakov, Swing dynamics. ... A.O. Belyakov, A.P. Seyranian, and A. Luongo, Regular and chaotic dynamics of the swing. 6th EUROMECH Nonlinear Dynamics Conference (ENOC 2008) , Saint Petersburg, Russia, June, 30 - July, 4 2008...
... Faculty of Soil Science, Moscow State University . ... Evaluation of acid deposition effects on soils as a component of forest ecosystems. ... Estimation and prediction of forest soil response to acid deposition with simple process-based models. ... Forest soil response to acid deposition, in particular the significance of soil organic matter in the processes of proton consumption, sulphur retention, aluminium and heavy metals mobilisation was investigated. ... Acid Deposition and Forest Soils. ...
I NSTITUTE OF PHYSICS PUBLISHING PHYSICAL B IOLOGY Phys. Biol. 3 (2006) 121129 doi:10.1088/1478-3975/3/2/004 Direct simulation of plastocyanin and cytochrome f interactions in solution I B Kovalenko1,AMAbaturova1, P A Gromov2,DMUstinin1, E A Grachev2, G Yu Riznichenko1 and ABRubin1 1 2 ... 2006 Online at stacks.iop.org/PhysBio/3/121 Abstract Most biological functions, including photosynthetic activity, are mediated by protein interactions ... We use this structure in our simulation. ...
Cell Biology International 27 (2003) 293294 Cell Biology International www.elsevier.com/locate/jnlabr/ycbir Short communication Microtubule dynamics in living cells : direct analysis in the internal cytoplasm Ivan A. Vorobjev a a,* , Irina B. Alieva a, Ilya S. Grigoriev b, Gary G. Borisy c Laboratory of Cell Motility, A.N. Belozersky Institute, Moscow State University, Moscow, Russia b Department of ... These data demonstrate that MT growth is impeded at the cell margin. ...
[
Текст
]
Ссылки http://cellmotility.genebee.msu.ru/html/articles/Vorobjev03.pdf -- 67.3 Кб -- 04.03.2004 Похожие документы
... Department of Vertebrate Zoology . ... Vertebrate Zoology - for the 1-year students (prof. L.P.Korzoun) . Special Vertebrate Zoology - elective course for the 2-year students studying zoology and botany (associate prof. S.V.Ogurtsov ) . ... Zoogeography (leading researcher V.V.Inanitskii) . ... Seminar 'Actual Problems of Vertebrate Zoology' - for the 5th year students (leading researcher M.E.Goltsman, researcher O.A.Filatova) . History of Zoology (leading researcher V.S.Shishkin) . ...
... Philosophical Transactions of the Royal Society (Biological Sciences) . ... Biochimica et Biophysica Acta (Elsevier Science) . ... Discrete and Continuous Dynamical Systems, Series B (American Institute of Mathematical Sciences) . ... Physics in Medicine and Biology (Institute of Physics) . ... Mathematical Medicine and Biology: A Journal of the IMA . Mathematical Medicine and Biology will publish original articles with a significant mathematical content addressing topics in medicine and biology. ...
... Manuscripts submitted to the journal should be divided into the following sections: Title page, Abstract (in Russian and English), Key words (in Russian and English), main manuscript text, list of references, tables, figures and figure captions. ... Full size of the article includes list of references, tables and figures. ... Rich text format (*.rtf) . ... References are given in the text in square brackets; full references are given at the end of the manuscript in the section List of references. ...
[
Текст
]
Ссылки http://www.antropos.msu.ru/vestnic/pravila_eng.doc -- 35.0 Кб -- 08.04.2015
[
Текст
]
Ссылки http://www.anthropos.msu.ru/vestnic/pravila_eng.doc -- 35.0 Кб -- 08.04.2015 Похожие документы
... References . ... References to books should include the author's name; year of publication; title; page numbers where appropriate; publisher; place of publication, in the order given in the example below. ... Ramirez, F. J., Marquez, R. A. C., and Mondaca, G.: 1991, The 1877 great tsunami and the rapid local warning network in the coast of Northern Chile - South America, In: Proc. International Conference of Australian Earthquake Engineering Society , Brisbane, Australia, 25-1. ... Information . ...
... V. Shirokova Numerical Solution of Piston-Like Oil Displacement for Periodic Systems of Oil Fields Development Vladimir Astafev, Andrey Kasatkin The Exploring of Kendari DHF Data for Screaning Disease Risk Assessment ... Construction in Determining Direct Method Strategy Masykur Kimsan, Morgan L. Setiady, Chandra Yudi Kusuma, Kurniati Ornam, Edi Cahyono Dynamical Systems with Variable ... Lemma 1 Systems of the form 12, 13 are dynamical system with zero mean variable dissipation. ...
... Living systems depository "Noah's Ark" . ... About the project . ... The project of the Moscow State University "Noah's Ark" is dedicated to the creation of multi-functional network storage of biological material. ... Creation of temporary prototypes of living systems depository bank for storage and research of the collected material. ... Development of algorithms for the information processes analysis in living systems for receiving, filing and processing of various types of biological data. ...
Preconcentration Laboratory . Laboratory of Chromatography . ... Laboratory of Kinetics Methods of Anaysis . ... Sorption-spectroscopy methods for determination of organic . ... Room-temperature ionic liquds, computational chemistry . ... New detection methods in ion and ion-pair chromatography . ... For that purpose, methods of selective preconcentration are developed along with the methods of determination of analytes directly in the sensing film or in the permeate after membrane diffusion. ...
Vol 444|30 November 2006 NEWS & VIEWS ARCHAEOLOGY High tech from Ancient Greece FranГois Charette The Antikythera Mechanism, salvaged 100 years ago from an ancient shipwreck, was long known to be some sort of mechanical calendar. ... LIBRARY, LEIDEN STEM-CELL BIOLOGY A move in the right direction Jeffrey S. Chamberlain Stem-cell therapy is valued for its potential to restore damaged or degenerating tissues. ... Although a variety of stem-cell types can become muscle cells when injected into the ...
Copyright 1998-2007 The Jmol Development Team This library is free software; you can redistribute it and/or modify it under the terms of the GNU Lesser General Public License as published by the Free Software Foundation; either version 2.1 of the License, or (at your option) any later version. This library is distributed in the hope that it will be useful, but WITHOUT ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. ...
... Solar Protons in the Earth's Magnetosphere from Riometric and Satellite Data During Magnetic Storms in October 2003 S. N. Kuznetsov, 1, L. L. Lazutin1, U. Manninen2, A. N. Podorolsky1, A. Ranta2, S. N. Samsonov3, A. V. Shirochkov4, and B. Yu. ... CONCLUSIONS The period of intense SEP events during strong magnetic storms in late October-early November 2003 provides a good opportunity for analyzing the relationship between riometric polar cap absorption and in situ solar proton measurements. ...
SVETKA, a program for Analysis of Multiple Sequence Alignments . ... Analyse your alignment . ... Alignment . Nota Bene! .aln or .fasta format required!! Look here for comments . ... Nota Bene! Special scheme format required! ... Development of the program is supported by Ministry of Education and Science of the Russian Federation (State Contract No. ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы