FNAL SELEX experiment. ... Моя Atlas страница здесь, в МГУ. ... Страница памяти Юрия Александровича Лазарева . ... Л.Д. Ландау ? ученый, учитель, человек?(.pdf) . ... Круг Ландау: Физика войны и мира?. 2009 г., 269 стр.) ... Л.Д. Ландау?(.pdf) . 32 стр.) ... Бонсай в Москве, декабрь 2015 г. Южная Индия в январе 2011 г. Петербург в ясном октябре 2010 г. Фото на станции метро Лубянка после теракта 29 марта 2010 г. (30 марта и 6 апреля). ... Фото Гелл-Манна , выступавшего в МГУ 25.09.2007. ...
О кафедре . ... Курс общей физики . ... Специальные курсы для студентов кафедры . ... Молекулярная электроника . ... Добро пожаловать на сайт кафедры! Всего несколько лет назад нанотехнология появилась в поле зрения всеобщего внимания, в основном, как символ и содержание очередного этапа миниатюризации электроники. ... Кафедра общей физики и молекулярной электроники уже более пятнадцати лет занимается исследованиями в области нанотехнологий. ... 2016 Кафедра Общей Физики и Молекулярной Электроники ...
... Елена Фоменко (2 курс). ... Руководитель В. И. Буник, отдел биокинетики НИИ ФХБ им. А.Н.Белозерского МГУ. ... Руководитель А.Г. Евстафьева, отдел химии и биохимии нуклеопротеидов НИИ ФХБ им. А.Н. Белозерского МГУ. ... Руководитель Н.В. Чичкова, лаборатория молекулярной биологии гена отдела химии и биохимии нуклеопротеидов НИИ ФХБ им. А.Н. Белозерского МГУ. ... Руководитель А.Г. Евстафьева, лаборатория молекулярной биологии гена отдела химии и биохимии нуклеопротеидов НИИ ФХБ им. А.Н. Белозерского...
... Along with the stable inner proton belt, temporal variations of the 1-15 MeV protons at L=2.5-3.5 have been reported, with intensity increases and decreases registered during and after strong magnetic storms. ... Our study presents experimental evidences that creation and destruction of solar proton belts in the inner magnetosphere may be produced by the fast shifts of the proton penetration boundary without additional acceleration and injection. ... Black line shows the 50-90 MeV proton profiles. ...
Supernova 2005cs in M51 . This page is devoted to information on Supernova 2005cs in NGC 5194 (= M51 ). ... Information on the original web pages for many of these images can be found on the updates and links web pages. Discovered by amateur Wolfgang Kloehr (Germany) [ Translate ]. ... SNWeb has a 2005cs page . ... Sky and Telescope news release on Supernova 2005cs . ... 2005/01/ . ... mirror . W. Kloehr image . ... Joel Nicolas image . ... Wolfgang Kloehr image . ... 2006/01/06.504 . ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
Russian TeX Disk . ... Please, use "Save link as" (right mouse button) for downloading files, otherwise binary files will be corrupted. What is russian TeX disk . ... Some TeX versions and tools are installed/russified and can be started directly from CD; other are only distributives plus additional files for their russification. ... FPTEX . ... Directory russian.add: Generic files (mf-sources, pfb-fonts and hyphen file) for russification of any-TeX-realizations in: . ... file readme: . ...
звоните, мы в Москве(926)6667253 art-sale@mail.ru . Начало www.99ru.ru Виниловые пластинки Запад 15614 . ... Искусство . История.Философия . ... Художественные . ... История Всемирная . ... Искусство и культура . ... Другие виды искусства . ... Теория искусств.Эстетика . ... Этнография Фольклор . ... Наследие Востока . ... Фольклор . ... СССР (после 1917) . ... Введите код товара из каталога. автор Kraftwerk . ... Западных уже нет, остались кое-какие лицензионные СССР звоните, тел.сверху . ...
Welcome to ASC14 To whom it may concern With the supports from the High Performance Computing (HPC) experts and organizations, the ASC13 Student Supercomputer Challenge has concluded with great success. ... We are calling for registration and preliminary contest preparation. ... Some of them may finally take HPC as a career option, such as some students from National Defense University team have already contributed to the Tianhe-1A and Tianhe2. ... Award Overall Gold Winner: 100K RMB (~16000 USD) . ...
[
Текст
]
Ссылки http://smu.cs.msu.ru/sites/default/files/attachments/ASC14%20Invitation%20Letter.pdf -- 1094.9 Кб -- 04.12.2013
[
Текст
]
Ссылки http://smu.cs.msu.su/sites/default/files/attachments/ASC14%20Invitation%20Letter.pdf -- 1094.9 Кб -- 04.12.2013
[
Текст
]
Ссылки http://smu.cmc.msu.ru/sites/default/files/attachments/ASC14%20Invitation%20Letter.pdf -- 1094.9 Кб -- 04.12.2013 Похожие документы
Revised: 21 May 2014, Accepted: 27 May 2014, Published online in Wiley Online Library (wileyonlinelibrary.com) DOI: 10.1002/jmr.2399 Force -induced globule-coil transition in laminin binding protein and its role for viral- cell membrane fusion Boris N. Zaitseva, Fabrizio Benedettib,e, Andrey G. Mikhaylovb, Denis V. Korneeva, Sergey K. Sekatskiib*, Tanya Karakouzb, Pavel ... 2008, 2010). ... This should permit us to elucidate still unclear aspects of viral-cell membrane interaction and fusion. ...
[
Текст
]
Ссылки http://cell.biophys.msu.ru/static/announce/media/files/Force-induced_globule-coil_transition_in_laminin_binding_protein_and_its_role_for_viral-cell_membrane_fusion.pdf -- 1182.2 Кб -- 30.11.2015 Похожие документы
... Кафедры . ... Krasnoslobodtsev V. P. Territorial availability of higher education in the Northern Caucasus. ... The Northern Caucasus with its relatively favorable demographic structure of population as compared to the rest of Russia is experiencing the profound growth in the availability of higher education. ... In 2007 90% of population of the Northern Caucasus lived within daily distance from higher schools providing mass and prestigious higher education (in law and economics, for example). ...
Magnetism Department MSU . ... Magnetism department . ... Research groups . ... Students . Phd students . ... For 2 grad students . ... Grad. students . ... Laboratories . Magnetic nanogeterostructures in spintronics (theory group) . Photonic crystals and magnetic nanostructures (theory group) . Magnetic materials research laboratory . Magnetic measurements laboratory . Magnetooptic laboratory . Magnetooptic spectroscopy laboratory . Surface magnetism laboratory . ...
. ПО КУ . Ссылки . Статьи и тезисы . Интернет . Литература . CVS-репозитории . Утилиты . Доступ к информации . Linux SAL Parallel Computing Page . http://suparum.rz.uni-mannheim.de/docs/ind.html . Partial evaluation for MPI optimization . Berkeley Reserach Areas . IOZone filesystem benchmark . SEL-HPC Article Archive . $Date: 2000/10/12 01:09:52 $ . Home . Andrey Slepuhin .
About BAFIZ . BAFIZ at SINP MSU . Bafiz' Information Resources at SINP . ... Information Services . ... Space Physics Information Home Page . The Centre for Photonuclear Experiments Data (Centr Dannykh Fotoyadernykh Eksperimentov, CDFE)" . Data Services . Data Base of Low Altitude Space Radiation Environment (DB LASRE SINP MSU) . Space Physics Data Archives . Space Physics Data On-Line Services . ... This Page is developed at Laboratory of Computational Mathematics, . ...
Space Weather . ... Space weather . ... Data . ... You should fill in "Workspace" by groups of data sets to create plots. ... Putting different kind of data into the same plot remember, that the first dropped data set chooses and determines the axis scale for all data. ... If you need both kind of scale in the same plot, create two different plots and unite them. The speed of this service depends on 3 components: data processing on server, data transmission and data plotting in your browser. ...
... Web portal on atmospheric environment is developed by international consortium as a be-lingual information resource in area of atmospheric physics and chemistry and in related domain air quality assessment and management. ... The portal has all typical component and services like collections of links, user group registration, discussion forum, etc. ... Each scientific site is an information-computational system designed in Internet technologies. ... 00189 138. ... 2003 . ... 2002, 252 . ...
... обзор arxiv:1507.03989 Программное обеспечение в астрономии: неформальный обзор (Software Use in Astronomy: an Informal Survey) . ... Comments: 11 pages . ... Польза от современных проектов по моделированию формирования галактик и крупномасштабной структуры максимизируется, если данные расчетов становятся общедоступными. ... Comments: ApJS, in press; 29 pages, 30 figures, including many code examples . ... Comments: 64 pages, 23 figures, submitted to Living Reviews in Computational Astrophysics . ...
... Аппаратура и измерения . ... Консультации по улучшению акустической обстановки, как на этапе строительства здания, так и в жилом помещении. ... Лаборатория опирается на коллектив кафедры акустики физического факультета МГУ , в активе которой более 2000 наименований измерительных приборов (в том числе современные приборы фирм Bruel&Kjaer, Tektronix, Fluke), а также экспериментальные установки - звукомерная заглушенная камера, реверберационная камера, бассейн для гидроакустических измерений и др. ...