... БИБЛИОТЕКА НИИЯФ МГУ . ... Полный список журналов ELSEVIER и SpringerLink доступных в 2011 году . ... Электронные ресурсы НИИЯФ МГУ . ... Acta Physica Hungarica, New Series, Heavy Ion Physics . ... Applied Physics Letters . ... аннотации . ... Astrophysical Journal, Astrophysical Journal Letters, Astrophysical Journal Supplement series . ... Journal of Physical Chemistry A . ... The European Physical Journal - Applied Physics . ... The European Physical Journal E: Soft Matter and Biological Physics ...
BS - 2D data processing program. BS is a windows version of the 2D X-ray data processing program BSL in use at the Daresbury Synchrotron radiation source, for the treatment of low angle diffraction data. ... It requires less memory, has separate window to see 1D graphics and allows export of the image in two common formats: BMP and TIFF. ... information about the data file .adc . add a constant to selected range in n frames from file .add . weighted addition of two images .arg . ...
... Научно-методический совет по иностранным языкам . ... Факультет иностранных языков и регионоведения . МГУ им. М.В. Ломоносова . Центр Дистанционного Образования Кафедра лингвистики и ИТ . ... которая состоится 10-11 июня 2010 г. на . факультете иностранных языков и регионоведения . ... Педагогические технологии обучения иностранным языкам с применением ИКТ: компьютерно-опосредованное обучение; . ... Дидактические аспекты дистанционного обучения иностранным языкам; . ...
The Laboratory of the Historical Information Science . ... The historical information science laboratory was founded within the structure of the source studies department on 8 December 1995 for the purpose of fulfilling the decision of the academic council of the History Faculty of 4 October 1991 about the transformation of a group for the application of mathematic methods and mainframes in historical research in the laboratory of historical information sciences. ... Senior laboratory assistant (2) . ...
... 2013 тАФ Academic Writing: Russian and International Experience (Moscow) . ... 2009 тАФ Media Imagination (Moscow) . 2008 тАФ University Among the Media: Innovation in Higher Learning and Changing Modes of Effective Communication (Moscow) . ... 2003 тАФ Reading Everyday Life in American and in Russian: Semiotics of Culture and Intercultural Communication (Yasnaya Polyana) . 2002 тАФ Popular Literature: American and Russian Experience in Cultural Myth-Making (Moscow) . ... Summer School 2016 . ...
... Основными задачами выставки было ознакомление общественности с естественнонаучными основами науки о человеке, создание Музея антропологии и оснащение кафедры антропологии образовательным материалом. ... Ключевые слова: антропология, музееведение, выставки, музеи, концепция, этнография, юбилеи . Федотова Т.К. Антропоэкологические исследования НИИ и Музея антропологии МГУ (стр. ... Ключевые слова: антропология, дворянство и купечество, живописный портрет, обобщенный портрет . ...
ABSOLUTE PROPER MOTIONS OF 331 OPEN CLUSTERS . ... The proper motions of stars in the fields of 331 open clusters were taken from Four-Million Star Catalog (4M-catalog) of positions and proper motions (Volchkov et al. ... The absolute proper motions for 21 young open clusters have been derived by comparison of precise relative proper motions of individual stars and their corresponding absolute proper motions. ... Sign of proper motions in RA . ... 0.0001 arcsec/yr . ... rms error in RA proper motion . ...
... Доктор филологических наук профессор Юрий Николаевич МАРЧУК является видным специалистом по прикладной и компьютерной лингвистике , машинному переводу, автоматическому анализу и синтезу текстов, терминологии и терминоведению, лексикологии и лексикографии, общему языкознанию. ... Белов Алексей Михайлович, преподаватель, кандидат филологических наук . ... Качалкин Анатолий Николаевич, профессор, доктор филологических наук . Кочергина Вера Александровна, профессор, доктор филологических наук . ...
Mechmath admission for internetional students . Specialist degree . ... Master degree . ... Master variants . ... About Faculty . ... Mathematics and Mechanics Faculty was created 1 May 1933 with a recovery of the faculty system inљ Lomonosov MSU . ... The faculty prepares high level experts of wide areas of Mathematics, Mechanics and Applying Mathematics , possessing theoretical knowledge and a technique of scientific experiment . ... 2016 Mechmath admission for internetional students ...
... Разработка и внедрение образовательных программ повышения квалификации специалистов в области инновационной деятельности . ... Master Degree in Geology . Master Degree in Management . Master Degree in Chemistry . ... 06/04/2016 . ... 29 марта 2016 г. День открытых дверей Высшей школы инновационного бизнеса . ... 27 марта 2016 года Московский государственный университет имени М.В.Ломоносова приглашает на весенний ДЕНЬ ОТКРЫТЫХ ДВЕРЕЙ . ... New technologies in gas chemistry . ...
... J. 15(2): 263-268 ї RUSSIAN ENTOMOLOGICAL JOURNAL, 2006 3I, a new program for creating Internet-accessible interactive keys and taxonomic databases and its application for taxonomy of Cicadina (Homoptera) 3I - новая программа для создания интерактивных определительных таблиц и таксономических баз данных для Интернета и ее применение в систематике цикадовых (Homoptera: Cicadina) Dmitry A. Dmitriev Д.А. Дмитриев Illinois Natural History Survey, 1816 South Oak Street, Champaign IL 61820, USA. ...
[
Текст
]
Ссылки http://zmmu.msu.ru/files/images/spec/Russ%20Ent%20J/ent15_3%20263_268%20Dmitriev.pdf -- 376.2 Кб -- 10.07.2013 Похожие документы
... VaST is a software tool for finding variable objects on a series of astronomical images. ... VaST performs object detection and aperture photometry using SExtractor on each image, cross-matches lists of detected stars, performs magnitude calibration with respect to the first (reference) image and constructs a lightcurve for each object. ... VaST FITS image viewer ./pgfv . ... Part I" PZP, vol. ... K. V. Sokolovsky, S. A. Korotkiy; "New Variable Stars Discovered by the NMW Survey" PZP, vol. ...
... CUDA Showcase - список приложений, использующих CUDA (на сайте NVidia). RapidMind Case Studies - примеры использования RapidMind для программирования ГПУ (и не только). AMD Stream Computing Blog - примеры использования вычислительной платформы AMD Stream Computing для программирования ГПУ от AMD. Core Image - компонент интерфейса программирования Mac OS X, использующий вычислительные мощности графического процессора для отрисовки эффектов пользовательского интерфейса. ...
... Basic Linux . ... PCMCIA . Sound . ... CLEVO 8750 running X Window . ... BIOS: Phoenix (256Kb Flash ROM, PnP 1.0a, APM 1.2, LBA) LCD: TFT 13.3" 1024x768 . ... PCMCIA: GL9382; 2x Type II or 1x Type III PC Card slots (with ZV support) . ... Battery: Ni-Mh or Li-Ion . ... Nor X Window neither PCMCIA worked. ... For CLEVO 8750, I found at least two RRs at which X Window works: 62Hz and 70Hz. ... To enable the mouse when working on console use GPM with "-dev/psaux -t ps2" options. ...
... distant.msu.ru . ... Видеоархив МГУ . Список курсов . ... Курсы факультетов МГУ . Факультет мировой политики . ... Курсы для школьников / Курсы от школ-партнеров / ГБОУ Гимназия ?1272 Курсы для школьников / Курсы от школ-партнеров / ГБОУ Гимназия ?1516 Курсы для школьников / Курсы от школ-партнеров / ГБОУ СОШ ?1159 Курсы для школьников / Курсы от школ-партнеров / ГБОУ Школа ?2065 Курсы для школьников / Курсы от ... Открытые курсы МГУ . ...
FNAL SELEX experiment. ... Моя Atlas страница здесь, в МГУ. ... Страница памяти Юрия Александровича Лазарева . ... Л.Д. Ландау ? ученый, учитель, человек?(.pdf) . ... Круг Ландау: Физика войны и мира?. 2009 г., 269 стр.) ... Л.Д. Ландау?(.pdf) . 32 стр.) ... Бонсай в Москве, декабрь 2015 г. Южная Индия в январе 2011 г. Петербург в ясном октябре 2010 г. Фото на станции метро Лубянка после теракта 29 марта 2010 г. (30 марта и 6 апреля). ... Фото Гелл-Манна , выступавшего в МГУ 25.09.2007. ...
... Improvement of Java type compiler using in language independent remote process calls in KBase project. 09/2011 present: Moscow State University, Dept. of Bioengineering and Bioinformatics (Russia) Scientific Research Java developer and lecturer Enhanced the CAMPS web resource (http://webclu.bio.wzw.tum.de/CAMPS2.0/) that enables multiple classification of transmembrane proteins. ... Developed web based UI for visualization of a graph of transmembrane protein families. ... Sutormin RA, Mironov AA. ...
[
Текст
]
Ссылки http://storage.bioinf.fbb.msu.ru/~roman/Sutormin_CV_aug2013.pdf -- 202.5 Кб -- 26.08.2013 Похожие документы
... Probe flash (energy/duration) . ... 0.01 J / 0.01 ms . ... Submersible unit (dimension/weight) . Power supply unit (dimensions/weight) . ... 300 x 300 x 50 mm / 1 kg . ... Power supply . ... The complete set of PrimProd fluorometer consists of the following mainframes: submersible probe, 12 DC on-board block power supply, IBM-compatible computer, connecting cables and cable-rope. ... Submersible probe. ... On-board power block provides the necessary voltage (42 V) supply at the submersible probe. ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
Russian TeX Disk . ... Please, use "Save link as" (right mouse button) for downloading files, otherwise binary files will be corrupted. What is russian TeX disk . ... Some TeX versions and tools are installed/russified and can be started directly from CD; other are only distributives plus additional files for their russification. ... FPTEX . ... Directory russian.add: Generic files (mf-sources, pfb-fonts and hyphen file) for russification of any-TeX-realizations in: . ... file readme: . ...