... Printed in U.S.A. NATURE OF NUCLEAR RINGS IN UNBARRED GALAXIES : NGC 7742 AND NGC 7217 O. K. Sil'chenko and A. V. Moiseev Special Astrophysical Observatory, Nizhnij Arkhyz 369167, Russia; moisav@sao.ru Received 2005 ... Isaac Newton Institute of Chile, Moscow Branch, Moscow 119992, Russia; olga@sai.msu.su ABSTRACT We have studied an unbarred Sb galaxy with a nuclear star-forming ring, NGC ... 1 7217, Pos. ... Left: Stellar velocity dispersion map for NGC 7217 according to the SAURON...
... However, derivation of its main equations from the free energy of a superconductor was only briefly described in the original paper [3], and some basic points of this procedure are still not completely understood. ... What is the sense of the free energy variation with respect to the vector potential of the magnetic field? ... Indeed, in practical calculations the GinzburgLandau equations are often used in combination with the GinzburgLandau free energy of the superconductor. ...
... There are corresponding results showing that the Poincare duals of certain totally ge odesic cycles, which we will call "special cycles", span a definite part (a refined Hodge component) of the cohomology of the locally symmetric spaces of standard arithmetic type associated to the orthogonal groups O(p, q). ... Math. ... KLM3] (with B. Leeb and M. Kapovich) The generalized triangle inequalities in symmetric spaces and buildings with applications to algebra, Memoirs of the AMS, Vol. ...
[
Текст
]
Ссылки http://www.dubrovinlab.msu.ru/files/Alltogether.pdf -- 334.8 Кб -- 15.09.2012
[
Текст
]
Ссылки http://dubrovinlab.msu.ru/files/Alltogether.pdf -- 334.8 Кб -- 15.09.2012 Похожие документы
Create user account [Комиссия, 3 семестр, 2014-2015] . ... Use an existing account . To create an account, please think out, a login and provide your valid e-mail address in the form above. ... This contest operates in \"simplified registration\" mode. ... Accounts created using simplified registration procedure cannot be used for participation in contests, which do not allow simplified registration. If you want a regular account, you may create an account using the regular registration . ...
... Home News Program Committee Organizing Committee Program Plenaries Special Sessions Registration Abstracts Accommodation Important dates Contacts Poster Links Conference Venue Video . On mathematical creative work of L.S. Pontryagin (By D.V. Anosov) . ... L.S.Pontryagin, P.S.Alexandrov and A.N.Kolmogorov . ... Photo by A.I.Pontryagina In the beginning of the 50s, L.S. went into (broadly understood) theory of ordinary differential equations, which had episodically drawn his interest earlier. ...
... Lorem ipsum dolor sit amet, consectetur adipisicing elit, sed do eiusmod tempor incididunt ut labore et dolore magna aliqua. ... Lorem ipsum dolor sit amet, consetetur sadipscing elitr. ... Lorem ipsum dolor sit amet. Lorem ipsum dolor sit amet, consectetur adipisicing elit, sed do eiusmod tempor incididunt ut labore et dolore magna aliqua. <div class="myclass">...</div> . ... Lorem ipsum dolor sit amet, consetetur sadipscing elitr, sed diam nonumy eirmod tempor invidunt ut labore et dolore magna. ...
... Роль Я-фокуса в поддержании и усилении депрессии . ... В статье рассматривается теория Я-сфокусированного внимания и процессов саморегуляции. ... В сущности, мы утверждаем, что депрессия является результатом неспособности или нежелания индивида выйти из саморегуляционного цикла после утраты значимого источника чувства самоуважения, смысла жизни и т.д., что поддерживается и усиливается развертыванием Я-сфокусированного внимания, которое мы рассматриваем как стиль депрессивной самофокусировки. ...
... Вт Май 12 14:54:36 MSD 2009 . Следующее сообщение: PARALLEL.RU - Новости, специальный выпуск [21/05/2009] . ... OpenCL: язык параллельного программирования для ускорителей http ://agora.guru.ru/ parallel На сайте семинара выложены фотографии с доклада Дж.Донгарры The current state, trends, and future of supercomputing , состоявшегося 20-го апреля 2009 года. http ://agora.guru.ru/ parallel /photo/dongarra/ ------------- НОВОСТИ МИРА ВЫСОКОПРОИЗВОДИТЕЛЬНЫХ ВЫЧИСЛЕНИЙ http :// parallel.ru / ...
... Keywords: boundary-layer depth, stable stratification, Ekman layer. ... Experimental data (23) Data sets used in this paper for empirical validation of the proposed SBL depth formulation are taken from three measurement sites ( Figure 1), namely, (i) Cabauw measurement station (Nieuwstadt, 1984; Van Ulden and Wieringa, 1996), (ii) BASIS (Baltic Air-Sea-Ice Study) field experiment (Launiainen, 1999), and (iii) ETH-Greenland expedition in summer 1991 (Ohmura et al., 1992). (i) Cabauw ...
... Moskovsky Alexander . ... Rogov Alexander . Modeling the reaction of hydrolysis of peptide bonds by trypsin by using quntum mechanical - molecular mechanical methods . ... Title: "Modeling Spectra of Molecular Clusters by Quantum Chemistry and Molecular Dynamics Methods" . ... Title: "Development of the Combined Quantum Mechanical - Molecular Mechanical Methods" . ... Title: "Modeling mechanisms of enzymatic hydrolysis reactions by the combined quantum mechanical - molecular mechanical methods" . ...
Lomonosov Moscow State University FACULTY OF ARTS 2011 ALEXANDER LOBODANOV DEAN OF THE FACULTY OF ARTS WxtЊ vҐЂЂxtzтxс4 g{x YtvтЂрч Ґy TЊрс уxЊx tvvx¶рxw |° ... Since 2003 he has been chairman of the Department of Semiotics and the General Theory of History, founded by him, the first of its kind in Europe. ... Department of Semiotics and the General Theory of Arts The Department of Semiotics and the General Theory of Arts is a theoretical department. ... Galina Zadneprovskaya manages this department. ...
... About choir . ... Conductor . ... Performance the Academic Choir of the Moscow State University in Crocus City Hall . ... Askerov Mirza-Aga Saftarovich , born in 1959, honored cultural worker of the Russian Federation, honored worked of the All-Russian Musical Society, candidate of pedagogical sciences. ... Since 1990 has been working with the Academic Choir of Moscow State University on the recommendation of professor V.V. Baranov, the honored cultural worker of the Russian Federation. ...
... Кафедры . ... Практика . Производственная практика 2015 . ... IS PLEASED TO WELCOME INTERNATIONAL STUDENTS TO . ... International students enjoy both a regular curriculum and an in-depth study of the Russian Language, Russian Culture and History of Russia. ... a certified Russian translation ofљ both the original of Secondary School Certificate (or equivalent) and its attachment. ... a certified copy of ID/passport (the original of ID/passport is to be produced on application) . ...
... В левой части открывшегося окна Group Policy найдите раздел Local Computer Policy | ... Windows Update . ... Дважды щелкните по строке Configure Automatic Updates , в открывшемся окне поставьте переключатель в положение Enabled. ... Задав настройки для параметра Configure Automatic Updates, щелкните Next Policy и в окне Specify intranet Microsoft update service location Properties поставьте переключатель в положение Enabled, а в обоих полях ввода текста обязательно введите http://wsus.chem.msu.ru . ...
... PNIAM (Pluggable Non Interactive Authentication Modules - встраиваемые неинтерактивные модули аутентификации) - проект ЦТТИ МГУ . ... Дистрибутив старой версии Т-системы, сделанный в МГУ для Linux/RedHat . ... Участие студентов в работах по кластерной тематике . ... Тезисы доклада на Всероссийской научной конференции "Высокопроизводительные вычисления и их приложения", г.Черноголовка, 30 октября - 2 ноября 2000г. "Динамическое распараллеливание программ на базе параллельной редукции графов. ...
. NON-STATIONARY OPERATION OF THE FAST-FLOW LASERS . AND NEW POSSIBILITIES OF CONTROLLING THE LASER OUTPUT CHARACTERISTICS . A.V. Mushenkov, A.Yu.Loskutov, A.I.Odintsov, A.I.Fedoseev and V.F.Sharkov . Physics department of M.V.Lomonosov Moscow State University, 119899, Vorob'evy gory, Moscow, Russia . Abstract . The dynamics of the lasing of the fast crossflow gas laser with the inhomogeneous steady state pumping in the unstable resonator by means of numerical modeling is investigated. Depending on the
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
Fluctuation in EAS development and estimates of energy and composition of the primary radiation by L. Dedenko, SINP, MSU 1) surface scintillation detectors (SD) 2) detectors of the Vavilov-Cherenkov radiation (VCR) 3) underground detectors of muons (UD) (with the threshold energy ~1 GeV). Yakutsk array Detectors readings · The various particles · of Extensive Air Showers (EAS) · at the observation level · hit detectors · and induce some signals sampled as · detector readings 18.05.2011. IWS. ...