Home . Database of structures of nucleic acid - protein complexes . ... List of complexes . Pfam families . SCOP families . Interaction classes . ... NPIDB . ... Information on SCOP and Pfam domains detected in protein chains is presented. ... Each family has its own web page with the list of entries that include domains of the family. ... List of SCOP domains occurred in DNA-protein and RNA-protein complexes is organized in tree-like form, according to the SCOP classification. ...
... M.V.Lomonosov Moscow State University . ... Physicists from Lomonosov Moscow State University studied the dynamics of multiple cavitation bubbles excited by a fs laser superfilament and developed a new approach for their control by laser pulse energy and external focusing. For the first time an innovative method of controlling the dynamics of cavitation bubbles excited by the distributed laser-plasma source (filament) was demonstrated. ... 119991, Moscow, . ...
Space Weather . ... Space weather . ... Data . ... You should fill in "Workspace" by groups of data sets to create plots. ... Putting different kind of data into the same plot remember, that the first dropped data set chooses and determines the axis scale for all data. ... If you need both kind of scale in the same plot, create two different plots and unite them. The speed of this service depends on 3 components: data processing on server, data transmission and data plotting in your browser. ...
Mechmath admission for internetional students . Specialist degree . ... Specialist variants . Master degree . ... Master variants . ... Scientific Research Training . ... We?ll tell you what you need to know about the Festival of Science. ... What is the Festival of Science, and why is it so attractive to all who have participated in it?both children and adults?that they look forward eagerly to each new Festival? ... 2016 Mechmath admission for internetional students ...
... VaST is a software tool for finding variable objects on a series of astronomical images. ... VaST performs object detection and aperture photometry using SExtractor on each image, cross-matches lists of detected stars, performs magnitude calibration with respect to the first (reference) image and constructs a lightcurve for each object. ... VaST FITS image viewer ./pgfv . ... Part I" PZP, vol. ... K. V. Sokolovsky, S. A. Korotkiy; "New Variable Stars Discovered by the NMW Survey" PZP, vol. ...
Заведующий кафедрой Head of the Chair . ... История кафедры . ... В 1966 г. для расширения ведущихся на кафедре научных работ в НИИ Ядерной физики МГУ был создан отдел физики плазмы (ОФП), в 1989 году переименованный в отдел микроэлектроники (ОМЭ). ... Сегодня по различным научным направлениям, ведущимся по специальностям, преподаваемым на кафедре атомной физики, физики плазмы и микроэлектроники, работает около 100 научных сотрудников, среди которых 12 докторов наук и около 50 кандидатов наук. ...
Synthesis and Use of Humic Derivatives Covalently Bound to Silica Gel for Np(V) Sequestration I.V. Perminova , L.A. Karpiouk, N.S. Shcherbina*, S.A. Ponomarenko§, St.N. Kalmykov, and K. Hatfield Department of Chemistry, Lomonosov Moscow State University, Moscow 119992, Russia Vernadsky Institute of Geochemistry and Analytical Chemistry, Russian Academy of Sciences, Moscow 119991, Russia § Institute of Synthetic Polymer ... I.V. Perminova, et al. ...
[
Текст
]
Ссылки http://www.mgumus.chem.msu.ru/publication/2006/2006-perminova-synthesis.pdf -- 258.4 Кб -- 09.07.2007
[
Текст
]
Ссылки http://mgumus.chem.msu.ru/publication/2006/2006-perminova-synthesis.pdf -- 258.4 Кб -- 09.07.2007 Похожие документы
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... Елена Фоменко (2 курс). ... Руководитель В. И. Буник, отдел биокинетики НИИ ФХБ им. А.Н.Белозерского МГУ. ... Руководитель А.Г. Евстафьева, отдел химии и биохимии нуклеопротеидов НИИ ФХБ им. А.Н. Белозерского МГУ. ... Руководитель Н.В. Чичкова, лаборатория молекулярной биологии гена отдела химии и биохимии нуклеопротеидов НИИ ФХБ им. А.Н. Белозерского МГУ. ... Руководитель А.Г. Евстафьева, лаборатория молекулярной биологии гена отдела химии и биохимии нуклеопротеидов НИИ ФХБ им. А.Н. Белозерского...
General Information . ... The conference is organized by the Sternberg Astronomical Institute (SAI) of Moscow University and the IAU Working group "Site-testing Instruments" . ... Use of site data in telescope operation and adaptive optics. ... Recent conferences on this subject (2007, 2008) demonstrated great interest of the community, hence the need for a new meeting. ... Unlike previous recent conferences, this meeting will cover all aspects of site monitoring for optical/IR astronomy. ...
... The Symposium's three breakout sessions focused on risks from different perspectives: enterprise use, resource constrained environments, and combating malicious use. ... Specifically, a DNS collaborative response, awareness, technical training, and future DNS security, stability, and resiliency collaboration should take precedence within the issues selected for further study and implementation. ... Breakout Session Overview.. ... 30 Appendix F: Combating Malicious Use Breakout Session Guide Book .. ...
[
Текст
]
Ссылки http://www.iisi.msu.ru/UserFiles/File/bayern2009/global_dns.pdf -- 502.2 Кб -- 02.04.2012
[
Текст
]
Ссылки http://www.ipib.msu.ru/UserFiles/File/bayern2009/global_dns.pdf -- 502.2 Кб -- 02.04.2012
[
Текст
]
Ссылки http://iisi.msu.ru/UserFiles/File/bayern2009/global_dns.pdf -- 502.2 Кб -- 02.04.2012 Похожие документы
... Only by numerical simulation. ... moment T (K) Dipole moment (D) Experiment Other example: Diffusion constant 200 250 298 350 400 2.40 2.37 2.48 2.59 2.80 2.25 The Distribution functions: radial distribution function 1 g (r) = N t =1 j i N TS N pair ( r - rij ) The Distribution functions: radial distribution function CC def 2 Work mode computer related 1) · Perform simulation , create trajectory file · Calculate properties timestep by timestep 2) · Perform ...
Laboratory of Microfluidics and Nanofluidics . Laboratory of Physical Chemistry of Modified Surfaces . ... Research . ... Laboratory of Micro- and Nanofluidics . ... Professor B.V.Derjaguin moved to the Laboratory with his research group as an Emeritus Professor. ... In 1993 Professor Olga I. Vinogradova took over the leadership of the Laboratory. In 2009 the Laboratory of Micro- and Nanofluidics was organized by Professor Olga I. Vinogradova at the Physics Department of the M.V.Lomonosov MSU. ...
... Keywords: anthropology, craniotrigonometry, skull angular morphometry, the Russian Imperial Romanov family, shaping angles parameters Sviridov A.A. Cranial study of population of Loyalty Islands (Melanesia) (p. 88) The aim of this work is to study cranial series of 67 skulls from the Loyalty Islands (Northern Melanesia), stored at Musee de l'Homme (Paris, France). ... The study of intragroup variability showed a difference in the cranial types of the population of the Lifou and Mare islands. ...
[
Текст
]
Ссылки http://www.antropos.msu.ru/vestnic/e2014_2.doc -- 71.0 Кб -- 23.07.2015
[
Текст
]
Ссылки http://www.anthropos.msu.ru/vestnic/e2014_2.doc -- 71.0 Кб -- 23.07.2015 Похожие документы
... Academic Programmes . ... Vestnik CIE (in Russian) . ... Elective Courses . ... The XIX century Russian Literature; . ... Open to all interested students, this course is especially useful for those who are preparing for Certificate examination (upper levels), or engaged in translation and interpreting; for teachers of Russian as a foreign language. The course s ultimate goal is to build a diversified set of skills that will enable students to explore various genres of Russian Media independently. ...
This domain may be for sale - этот домен возможно продается . ... The gathered information about your visits to this and other websites are used by these third party companies in order to provide advertisements about goods and services of interest to you. ... If you would like more information about this practice and to know your choices about not having this information used by these companies, click here . ...
The Shigeyoshi Matsumae Stadium in Moscow University was opened on September 1, 1989, on the campus of Moscow University, as the first full-scale stadium having artificial turf in the Soviet Union (at that time). ... The stadium was a gift by Tokai University to Moscow University, as the result of more than 20 years of exchange and friendship between Tokai University and Moscow University in exchanging students and teachers, as well as academic and cultural works since 1973. ...
... Инструкция по работе с информационными ресурсами в ОРОКС . ... Основные разделы сервера: Выбор раздела сервера ------------------------------------ На первую страницу "ChemNet" ------------------------------------ Химический факультет МГУ ------------------------------------ Электронная библиотека по химии ------------------------------------ Базы данных и другие источники информации по химии ------------------------------------ Периодические издания по химии -- Вестник МГУ. ...
... MATHEMATICAL AND SYSTEM BIOLOGY UDC 577.1 Membrane Profile-Based Probabilistic Method for Predicting Transmembrane Segments via Multiple Protein Sequence Alignment R. A. Sutormina and A. A. Mironova a b , b, c State Research Center GosNIIgenetika, Moscow, 117545 Russia; e-mail: sutor_ra@mail ... Bioinformatics, Moscow State University, Moscow, 119992 Russia Received January 25, 2006 Abstract--Prediction of transmembrane (TM) segments of amino ... Protein Sci. ... Proteins. ...
[
Текст
]
Ссылки http://storage.bioinf.fbb.msu.ru/~roman/mol_biol_mosk_2006.pdf -- 151.6 Кб -- 25.05.2006 Похожие документы
... Студенческая Астрономическая обсерватория ГАИШ . ... Любителям астрономии . История ГАИШ и Московской обсерватории . ... Структура ГАИШ : Отдел внегалактической астрономии : . ... Welcome to the Extra-galactic research group of SAI ! ... Sternberg Astronomical Institute is older than the entire field of extra-galactic astronomy. ... At the same time, the Extra-galactic astronomy group as an element of the institute structure remains the youngest subdivision of SAI. ... 2007, astro-ph/0709.3047 . ...