. КОМПЬЮТЕРЫ . Решение астрономической задачи N тел на кластере из ГПУ (pdf) . Exploring weak scalability for FEM calculations on a GPU-enhanced cluster (pdf) . Using GPUs to Improve Multigrid Solver Performance on a Cluster (pdf) . ClawHMMER: A Streaming HMMer-Search Implementation (pdf) . Проект Folding@Home . Лаборатория Параллельных информационных технологий НИВЦ МГУ .
. # . Home . Services . Interaction . Calculate Hydrogen bond, Water bridges and Hydrophobic interaction for . Home Browse Download Help About Us . List of complexes . Pfam families . SCOP families . Interaction classes . Interaction modes . GO terms . ERROR! File was not found. NPIDB team 2003 - 2016 . text .
Table 1. ... Areas: 1 - central waters; 2 - the Bay of Riga; 3 - the Lithuanian coast; 4 - the Bay of Gdansk; 5 - the Pomorskaya Bay; 6 - the coastal waters between 4 and 5;. * - the results were averaged over several measurements. ... 12-15 . ... 134 . ... 124 . ... 140 . ... 145 . ...
... Geography of World Economy . ... Cryolithology and Glaciology . ... Departments . ... Research laboratories . ... Field stations . ... Type of field courses . ... Department of Cryolithology and Glaciology The Department was founded in 1945 with the name Department of northern countries . ... Our students are active members of PYRN (Permafrost Young Researchers Network), in which they share best practices, information about conferences, field courses, jobs. ... ISBN 5-89176-095-9 . ...
... 5) Two variant of calculation: Main 1 (absence of SNRs in the Earth vicinity with Emax =4 PeV ) and Main 2 (where 4 SNRs accelerate to 4 PeV ) give more or less similar structures around the knee Here we need to know MetaGalactic Sum Gal+Metag 025 0.20 · 10 7 · F(E) E 10 6 P He 3 .0 Fe · 10 5 C,O Si Pure Galactic · 10 4 10 4 10 5 10 6 10 7 10 8 10 9 10 10 10 11 10 12 E, GeV Contribution of nearby actual sources 10 1 Main 2 all p he cno si fe nearby ...
... ICONO Invited Speakers . ... Gennadiy Kulipanov, Budker Inst. of Nuclear Physics, Russia . ... Marlan Scully, Texas A&M Univ., ... Andrey Goncharov, Inst. of Laser Physics, Russia . ... Vladimir Trunov, Inst. of Laser Physics, Russia . ... Since 1987, he has worked at the National Research Council of Canada (Ottawa) in the field of laser physics and trapped ion optical frequency standards. ... Alexey Taichenachev , Inst. of Laser Physics, Russia . ... S. Vatnik, Inst. of Laser Physics, Russia . ...
MATSYM - symbolic matrix processor . ... To use the program you will need a MAT file (liked CIR file: "User manual for CIRSYM program") of your system. ... In first string of MAT file enter any text you want to be the title of your system. ... Starting from string 2 (if is not comments - "*") enter the system element name, incident row and column and, optionally, its value. ... To generate a solution, run MATSYM.exe and enter "system_file_name.CIR" or click on the "ENTER" (in "MAT" case). ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
THE RUSSIAN STYLE OF CIVIL PROCEDURE Dmitry Maleshin Reprinted from Emory International Law Review Volume 21, No. ... 26 See id. ... Another exceptional feature of the Russian civil procedure is the original status of judicial precedent as a source of Russian civil procedural law. ... 98 See OSCAR G. CHASE, LAW , CULTURE, AND RITUAL: DISPUTING SYSTEMS IN CROSS-CULTURAL CONTEXT 53-55 (2005); JAMES ET AL., supra note 6, at 309-10; THOMAS MAIN, GLOBAL ISSUES IN CIVIL PROCEDURE 5 (2006); Oscar G. Chase. ...
The Department of Talented Youth Affairs and Professional Orientation . ... International Biological Universiade . ... November 22, 2015 the International Biological Universiade was closed at Lomonosov Moscow State University. The Universiade is aimed at the expansion of educational space. ... In 2015 the V International Biological Universiade was attended by 46 teams. ... The Universiade was held in two rounds. ... 2016 - The Department of Talented Youth Affairs and Professional Orientation ...
... Moscow State University Russian Language Centre . Moscow State University . ... The global Internet company is looking at international market expansion with Russian language version. ... That's why the Moscow Lomonosov University is pleased to offer you one-to-one express-courses of Russian at your option. ... The German delegation in the Moscow State University . ... The Tolstoy Foundation was created in New York City in 1939 by Alexandra Tolstoy, the youngest daughter of author Leo Tolstoy. ...
... The 2016 Beacon Satellite Symposium will be held at the International Centre for Theoretical Physics (ICTP) at Trieste, Italy, from 27 June to 1 July 2016. ... Абстракты - 15/02/2016 . Подробнее на сайте: http://t-ict4d.ictp.it/beacon2016 . Конференция "Распространение радиоволн" имеет более чем 40-летнюю историю и проводится раз в два-три года в центральных городах России. 15 декабря 2015 г. - начало регистрации участников и представления текстов докладов . ... D.Физика атмосферы . ...
Communicating Through Art, L.Vershbow . ... But here I am, and as a designer, I will attempt to explain to you how I perceive art and design as a form of communication. Most of us think of art as the works that hang in museums and on the walls of our homes. ... But art, design and symbols, whether they are aesthetically pleasing or not, are all around us, and they help to guide us through the complexities of everyday society. ... Today I am a designer and creator of contemporary jewelry. ...
... Fast Facts about the Faculty of Journalism . ... Academic Departments . ... Full-time programs . ... Partners . ... All partners . ... Attraction of international students, development of cooperation with foreign partner universities is one of the priorities for the Faculty of Journalism. ... Foreign citizens can enter the Faculty of Journalism on a contract basis according to specific rules. ... Faculty of Journalism provides foreign applicants with a standard visa invitation. ...
... 11:00-11:30 Break 11:30-12:00 Lecture 3 Prof . Heinz Oberhammer , Institute of Physical and Theoretical Chemistry , University of Tubingen, Germany Structures and Conformations of Disilacyclohexanes 12:00-12:30 Lecture 4 Prof . Ingvar Arnason , University of Iceland, Iceland Energetics and Potentional Energy Surfaces of Disilacyclohexanes 12:30-13:00 Lecture 5 Prof . Igor Godunov, Chemistry Department , MSU , ...
Automorphisms and isomorphisms of Chevalley groups of typ e G2 over lo cal rings with 1/2 and 1/3 E. I. Bunina M.V. Lomonosov Moscow State University Russia, 119992, Moscow, Leninskie Gory, Main Building of MSU, Faculty of Mechanics and Mathematics, Department of Higher Algebra email address: helenbunina@yandex.ru Abstract. ... We describe automorphisms of Chevalley groups of type G2 over local rings with 1/2 and 1/3. ... References [1] Abe E. Automorphisms of Chevalley groups over commutative rings. ...
[
Текст
]
Ссылки http://halgebra.math.msu.su/wiki/lib/exe/fetch.php/staff:bunina:autg2_eng.pdf -- 224.0 Кб -- 13.02.2013 Похожие документы
... He distributes these gifts in sacks (each sack can contain from 1 to n items) and puts the sacks with gifts around the Christmas tree (only the content of the sacks and their ordering on the circle around the tree are important). ... A river falling into a sea forms a delta which is a system of branches consisting of channels without inner intersections. (a) Suppose that in a given delta there are exactly n different (i.e. differing by at least one channel) routes down the stream. ...
LUT Summer School: www.lut.fi/summerschool summerschool@lut.fi Guide for Student Advisers Greetings from your colleagues at Lappeenranta University of Technology! ... With the wide-ranging selection of courses on-offer during the LUT Summer School we aim to both challenge and inspire students. ... Lappeenranta and LUT Lappeenranta is located some 220 km northeast of Finland's capital, and about 230 km northwest of St. Petersburg, Russia. ... The fee will be given on the LUT Summer School web pages. ...
[
Текст
]
Ссылки http://www.phys.msu.ru/rus/about/structure/admin/OTDEL-FOREIGN/INVITATIONS/LUT_Summer_School_2013_staff.pdf -- 448.5 Кб -- 17.01.2013 Похожие документы
... 07.04.2016 (Thursday) Session 1 10:00-10:20 10:20-10:40 10:40-11:00 11:00-11:20 11:20-11:40 (chairman M. Stynes) N. Kopteva V. Andreev H.-G. Roos S. Franz, H.-G. Roos A posteriori error estimates for singularly perturbed reactiondiffusion problems on anisotropic meshes. ... Numerical solution of a singularly perturbed initial-boundary value problem with a Neumann condition for a parabolic equation. ... Boundary layer solutions to time-periodic singularly perturbed parabolic problems. ...
[
Текст
]
Ссылки http://math.phys.msu.ru/data/283/Programme_13th_Workshop.pdf -- 621.4 Кб -- 05.04.2016 Похожие документы