Publications of O. Senko . ... Publications of Group . ... Chemical Enzymology Department, Chemical Faculty . The M.V. Lomonosov Moscow State University, Lenin's Hills, 1/11 Moscow 119992, Russia . ... 7 (495) 939-31-70, Fax: +7 (495) 939-31-70, +7 (495) 939-54-17 . ... Master's Degree, Moscow State Academy of Fine Chemical Technology, (2005) . ... Bachelor of economy, Moscow State Academy of Fine Chemical Technology, (2004) . ... Publications: . Number of Patents and Patent Proposals: 1 . ...

Еще в разделе: (Показать все результаты (>131) - www.enzyme.chem.msu.ru/ )

Home . Database of structures of nucleic acid - protein complexes . ... List of complexes . Pfam families . SCOP families . Interaction classes . ... NPIDB . ... Information on SCOP and Pfam domains detected in protein chains is presented. ... Each family has its own web page with the list of entries that include domains of the family. ... List of SCOP domains occurred in DNA-protein and RNA-protein complexes is organized in tree-like form, according to the SCOP classification. ...

Еще в разделе: (Показать все результаты (>6) - npidb.belozersky.msu.ru/ )

Chemistry of Heterocyclic Compounds, Vol. ... 8, 1995 INSTRUCTIONAL TECHNIQUE IN HETEROCYCLIC CHEMISTRY COMPUTER ANIMATION: A NEW METHOD AND REPRESENTATION IN HETEROCYCLIC FOR TEACHING, OF KNOWLEDGE COMMUNICATION, ABOUT REACTIONS CHEMISTRY E. V. Babaev We propose the use of computer animation techniques .for representation of knowledge about organic reactions, in particular as applied to syntheses and transformations of heterocTcles. ... Let us briefly consider the capabilities of this program. ...

Еще в разделе: (Показать все результаты (>119) - www.chem.msu.ru/ )

• http://www.chem.msu.ru/eng/misc/babaev/papers/024e.pdf
• Dmitriy Mendeleev Online

... Only by numerical simulation. ... moment T (K) Dipole moment (D) Experiment Other example: Diffusion constant 200 250 298 350 400 2.40 2.37 2.48 2.59 2.80 2.25 The Distribution functions: radial distribution function 1 g (r) = N t =1 j i N TS N pair ( r - rij ) The Distribution functions: radial distribution function CC def 2 Work mode ґ computer related 1) Ї Perform simulation , create trajectory file Ї Calculate properties timestep by timestep 2) Ї Perform ...

Еще в разделе: (Показать все результаты (>19) - www.elch.chem.msu.ru/ )

• http://www.elch.chem.msu.ru/mole/lecture/qprice.pdf
• Oleg A. Petrii
• Laboratory of Electrical Double Layer and Electrode Kinetics

Krejnes, M. A., Morozova E. A., Chentsov, N. N. XIII Moscow School Mathematical Olympiad. Uspekhi Mat. Nauk 5 (1950), No. 5 (in Russian). ... Congress 2 (1956) (in Russian). ... Mat. ... Morozova, E.A., Petrakov, I. S. International Mathematical Olympiad (completed 2-nd publication). ... Morozova, E.A., Petrakov, I. S., Sevorcov, V. A. International Mathematical Olympiad (completed 4-nd publication). ... Morozova, E. A., Chentsov, N. N. Matrices of probabilities and stochastic supermatrices. ...

Еще в разделе: (Показать все результаты (>165) - higeom.math.msu.su/ )

• Alexey Garber
• Publications (English)
• Index of /~asmish/Lichnaja-2010/Version2010-11-20/Trudy/Publications/1970

... 1998 1 : Defended the Doctorate Degree Thesis on "Models of Cosmic Ray Particle Fluxes (Development and Applications)". ... Space Weather . ... Nymmik R.A., Radiation Environment Induced by Cosmic Ray Particle Fluxes in International Space Station Orbit According to Recent Solar and Galactic Cosmic Ray Models, Adv. ... Nymmik R.A., Radiation Environment Induced by Cosmic Ray Particle Fluxes in International Space Station Orbit According to Recent Solar and Galactic Cosmic Ray Models, Adv.Space Res. ...

Еще в разделе: (Показать все результаты (>9) - srd.sinp.msu.ru/ )

Here is a list of previous events held by our Department. April 23, 2012 . Round Table Repeated Speech: Between a Commonplace and an Artistic Experiment held as a part of the Lomonosov Readings conference. ... Lecture Language, Culture and Hegemony: Rethinking the Politics of Culture in the ?б??ntext of the Russian Revolution . ... Round Table . ... November 30, 2011 . ... Round Table Reading a Monument: A Memorial Place in the City (held as a part of the conference Polyphony of the City ). ...

Еще в разделе: (Показать все результаты (>11) - discours.philol.msu.ru/ )

• Publications
• Summer School 2016

Вы посетили: arzhantsev_s_a_publications . ... История кафедры . ... On restriction of roots on affine T-varieties, Beitr?ge zur Algebra und Geometrie / Contributions to Algebra and Geometry 55 (2014), no. ... Journal of Pure and Applied Algebra 218 (2014), no. ... Сибирский математический журнал 53 (2012), вып.6, 1354-1372 . ... Математический Сборник 203 (2012), вып.4, 47-60 . ... staff/arzhantsev_s_a_publications.txt Последние изменения: 10.05.2015 22:32 От arjantse | ...

Еще в разделе: (Показать все результаты (>21) - halgebra.math.msu.su/ )

• staff:arzhantsev_publications | Кафедра высшей алгебры

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>9) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

... Electronic journal Issue 4. 10 september 2004 Leigh E. Making Learning a Game Introduction. As a university lecturer I enjoy playing games with learning goals in mind. My students are all adults who work in many different roles. ... Their needs include learning how to design activities that will support acquisition of practical skills, extend personal understanding of emotional factors, and improve awareness of factors ґ such as economic, ecological and political aspects of society. ... Play. ...

Еще в разделе: (Показать все результаты (>8) - e-journal.spa.msu.ru/ )

• http://e-journal.spa.msu.ru/uploads/vestnik/2004/vipusk_4._sentjabr_2004_g./vorontchuk.pdf
• http://e-journal.spa.msu.ru/uploads/vestnik/2004/vipusk_4._sentjabr_2004_g./bonham_surin.pdf

... B.V. Somov . head of the department . ... room 80 . ... senior research felow . ... research felow . ... research fellow . ... Our department performes the following most perspective studies: . Special analytical and numerical experimental investigations of the solar plasma involved in the magnetic reconnection process at the Sun. ... Head of the seminar: Prof. B.V. Somov. ... 27 September 2013 The Solar Physics Department was visited by journalists of the leading Russian TV channel "Vesti-1". ...

Еще в разделе: (Показать все результаты (>3) - sun.sai.msu.ru/ )

... Институт . ... Студентам . Приветствуем вас на Официальном сайте Русско-германского института науки и культуры. Published by admin on April 6, 2016 under Новости . ... No Comments ? ... 09.00 - 15.30      736 - 1.ГУМ . ... Морозова Е.Б. пн.  17-00? 18-30, 18-45?20-15, 20-30?21-15  1 к., ауд.736 1 ГУМ . ... Башкиров В. М. вторник 15.00-17.00, четверг  15.00-17.00, 1 ГУМ ауд.736 . вторник 17.00-19.00, пятница 17.00-19.00 1 ГУМ ауд.736 . ... 736 1 Гум) . ... 7361 Гум) . ... December 2011 . ...

Еще в разделе: (Показать все результаты (>2) - rgi.msu.ru/ )

. Select a spacecraft Meteor 1 Meteor 2 Relec Electro .

Еще в разделе: (Показать все результаты (>3) - dec1.sinp.msu.ru/ )

Neutron diffraction researches of nuclear and magnetic structure of new materials and its correlations with physical properties . Duration of training : 1 year . Supervisor of studies : A.M.Balagurov (professor, D.Sc., bala@nf.jinr.ru ) . ... In FLNP JINR there are unique opportunities for neutronography researches of nuclear and magnetic structure of crystals. ... Supervisor of studies: V.Yu.Pomjakushin (Ph. ... The near order and magnetic structure in amorphous magnetics. ...

Еще в разделе: (Показать все результаты (>25) - foroff.phys.msu.ru/ )

• Key research directions
• Postdoctoral training (General Physics and Wave Processes)

... В данном разделе приводятся публикации проекта по созданию семейства реконфигурируемых вычислительных систем в рамках государственного контракта N 02.524.12.4002 от 20 апреля 2007 г. федеральной целевой программы "Исследования и разработки по приоритетным направлениям развития научно-технологического комплекса России на 2007-2012 годы". ... Материалы Международной научной конференции "Параллельные вычислительные технологии" (ПаВТ 2008), г. Санкт-Петербург, 29 - 31 января 2008, Россия. ... Минск,...