Thunderstorms and Elementary Particle Acceleration . ... Conference . The first announcement . ... The Thunderstorms and Elementary Particle Acceleration (TEPA-2012) conference is the second one devoted to the studies of the extreme atmospheric effects connected with amplification of electric fields in the lower atmosphere. ... TEPA-2012 conference will be held from July 9 till July 11, 2012, just after the 23rd European Cosmic Ray Symposium also organized by MSU ( http://ecrs2012.sinp.msu.ru ) . ...

Еще в разделе: (Показать все результаты (>2) - tepa2012.sinp.msu.ru/ )

Space Weather . ... Space weather . ... Data . ... You should fill in "Workspace" by groups of data sets to create plots. ... Putting different kind of data into the same plot remember, that the first dropped data set chooses and determines the axis scale for all data. ... If you need both kind of scale in the same plot, create two different plots and unite them. The speed of this service depends on 3 components: data processing on server, data transmission and data plotting in your browser. ...

Еще в разделе: (Показать все результаты (>3) - swx.sinp.msu.ru/ )

A.Nekipelov Modernization of Basic Research in Russia: Russian Academy of Sciences ( RAS ) Vision Joint Session of Russian Academy of Sciences, Institute of France Academy of Sciences and Academy of Technology of France Paris, 2010, September 28 1 RAS in Russian Basic Science Potential (per cent, 2008) Russian Federation Research Organizations 100,0 RAS 12,7 Overall Personnel ... Who is the main actor in research: an institute or a laboratory? ...

Еще в разделе: (Показать все результаты (>20) - www.mse-msu.ru/ )

• http://www.mse-msu.ru/Bassanini_Mosca_rev4.pdf

... ICONO Invited Speakers . ... Gennadiy Kulipanov, Budker Inst. of Nuclear Physics, Russia . ... Marlan Scully, Texas A&M Univ., ... Andrey Goncharov, Inst. of Laser Physics, Russia . ... Vladimir Trunov, Inst. of Laser Physics, Russia . ... Since 1987, he has worked at the National Research Council of Canada (Ottawa) in the field of laser physics and trapped ion optical frequency standards. ... Alexey Taichenachev , Inst. of Laser Physics, Russia . ... S. Vatnik, Inst. of Laser Physics, Russia . ...

Еще в разделе: (Показать все результаты (>5) - iconolat13.phys.msu.ru/ )

• Excursions
• Symposia

... Dear creators of the Bensons courses! First of all I would like to thank you for such a magnificent English course! ... Look, it's really much more interesting - to listen to a virtual book, to look through the pictures, let alone role-play! ... However, I'm very glad that I took up "Bensons" - the course has given me wonderful possibilities to learn more about English culture, to fill some gaps in my knowledge of English grammar and just to spend my time with great pleasure and benefit! ...

Еще в разделе: (Показать все результаты (>6) - anazarenko.ffl.msu.ru/ )

• Факультет иностранных языков МГУ. Центр Дистанционного обучения.

Chemistry of Heterocyclic Compounds, Vol. ... 8, 1995 INSTRUCTIONAL TECHNIQUE IN HETEROCYCLIC CHEMISTRY COMPUTER ANIMATION: A NEW METHOD AND REPRESENTATION IN HETEROCYCLIC FOR TEACHING, OF KNOWLEDGE COMMUNICATION, ABOUT REACTIONS CHEMISTRY E. V. Babaev We propose the use of computer animation techniques .for representation of knowledge about organic reactions, in particular as applied to syntheses and transformations of heterocTcles. ... Let us briefly consider the capabilities of this program. ...

Еще в разделе: (Показать все результаты (>84) - www.chem.msu.ru/ )

• http://www.chem.msu.ru/eng/misc/babaev/papers/024e.pdf
• http://www.chem.msu.ru/eng/misc/babaev/papers/027e.pdf

... Chemical Department . ... 7 (495) 939-31-70, Fax: +7 (495) 939-31-70, +7 (495) 939-54-17 . ... 1999 - 2004 . Master's Degree, The M.V. Lomonosov Moscow State University, Chemical Faculty, Chemical Enzymology Department (2004) . ... Strong background in Chemistry (Biochemistry, Organic chemistry, Analytical chemistry, Inorganic chemistry, Physical chemistry, Chemistry of polymers, Radio-chemistry), biochemistry, molecular biology, Physics (course of Theoretical physics, the Theoretical mechanics) . ...

Еще в разделе: (Показать все результаты (>109) - www.enzyme.chem.msu.ru/ )

• Group of microbial biochemistry and biotechnology

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>9) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

... 247th American Chemical Society National Meeting and Exposition "Chemistry and materials for energy" , March 16-20, Dallas, TX Talk: A.V. Nemukhin "QM/MM-based modeling of structure and spectra of fluorescent proteins" . ... IV International Symposium "Topical Problems of Biophotonics", July 21-27, Nizhny Novgorod Invited talk: M.G. Khrenova , A.V. Nemukhin, A.P. Savitsky "Molecular modeling of the Forster resonance energy transfer between fluorescent proteins" . ...

Еще в разделе: (Показать все результаты (>12) - lcc.chem.msu.ru/ )

• Publications
• Current Projects

... Scaliger sometimes forgot as anyone will when doing chronological computations whether he sought a current or a completed year, and therefore gave Julian dates that did not actually match the cyclical dates his computations had determined (e.g. eras 37,42, and 49). ... This table lists all the eras explicitly given as such by Scaliger, with their positions in the Julian Period and their dates in years BC or AD. ... To find a year in this era, subtract 296 from the date in the era of the Hegira. ...

Еще в разделе: (Показать все результаты (>79) - hbar.phys.msu.ru/ )

• newtrev2.htm

PHYSICAL REVIEW A 68, 022309 2003 Entangling quantum measurements and their properties B. A. Grishanin* and V. N. Zadkov International Laser Center and Department of Physics, M. V. Lomonosov Moscow State University, 119899 Moscow, Russia Received 20 December 2002; published 20 August 2003 We study the mathematical structure of superoperators describing quantum measurements, including the entangling measurement --the generalization of the standard quantum ...

Еще в разделе: (Показать все результаты (>69) - qilab.phys.msu.ru/ )

• Quantum Information Lab, Int'l Laser Ctr. and Faculty of Physics, M.V.Lomonosov

... В данном разделе приводятся публикации проекта по созданию семейства реконфигурируемых вычислительных систем в рамках государственного контракта N 02.524.12.4002 от 20 апреля 2007 г. федеральной целевой программы "Исследования и разработки по приоритетным направлениям развития научно-технологического комплекса России на 2007-2012 годы". ... Материалы Международной научной конференции "Параллельные вычислительные технологии" (ПаВТ 2008), г. Санкт-Петербург, 29 - 31 января 2008, Россия. ... Минск,...

213. August 2012 Лаборатория лазерной интерферометрии

214. THEORETICAL PRINCIPLES AND METHODS OF REMEDIATION OF SOILS POLLUTED WITH HEAVY

215. http://www.antropos.msu.ru/vestnic/e2014_2.doc

216. Инструкции для преподавателей по работе в системе дистанционного обучения