... Конкурс У.М.Н.И.К. Объявления . ... Лучший молодой ученый года иљ . ... Конкурс научных работ молодых ученых МГУ (?Конкурс СМУ 2016?) Объявлен 40-й Конкурс научных работ молодых ученых МГУ, проводимый СМУ МГУ.љ ... 20 октября 2016 г. состоится полуфинальная конференция У.М.Н.И.К. 20 октября 2016 г. (ориентировочная дата) на Физическом факультете МГУ љ состоится полуфинальная конференция на получение премии поддержки молодых ученых У.М.Н.И.К. љ 20 октября 2016 г. состоится полуфинальный .. ...
... Faculty of Basic Medicine, Lomonosov Moscow State University and State Research Center Institute for Biomedical Problems, Russian Academy of Science invite you to take part in "VI Russian National School with International Participation on Muscle and Exercise Physiology "Systemic and cellular mechanisms in physiology of motor system". ... We invite scientists, post-grade students, residents and students to take part in School on systemic and cellular mechanisms in physiology of motor system. ...
[
Текст
]
Ссылки http://www.fbm.msu.ru/upload/conf/20110201/Information_letter_2011_eng.pdf -- 232.1 Кб -- 11.10.2010
[
Текст
]
Ссылки http://fbm.msu.ru/upload/conf/20110201/Information_letter_2011_eng.pdf -- 232.1 Кб -- 11.10.2010 Похожие документы
... Публикация в Интернете электронных журналов . ... Использование дистанционных образовательных технологий в обучении . ... Использование дистанционных образовательных технологий в преподавании химии . ... Информация о дистанционном обучении на Химическом факультете МГУ . ... Возможность обучения на основе фактически индивидуальных занятий с преподавателями выбранного вуза . ... Изучение вопросов восприимчивости дистанционного обучения и адекватности оценок знаний методом дистанционного тестирования ....
Конференция . ... 1-е сообщение . ... Тезисы (подготовка) . ABSTRACTS (SEND) . ... Тесные двойные звезды в современной астрофизике . MARTYNOV-2006: REGIONAL ASTRONOMICAL CONFERENCE) . Всероссийская Астрономическая Конференция "Тесные двойные звезды в современной астрофизике", пройдет с 22 по 24 мая 2006 г. в Государственном Астрономическом институте им. П.К.Штернберга. ... Регистрация участников продлена до 15 марта 2006 г. Опубликована предварительная версия Сборника Тезисов конференции. ...
... Linguistic expeditions . ... Logical and stylistic aspects of lexical semantics . ... Linguistic phenomena can be approached and described from various perspectives. ... The approach proposed here is distinctive in that it is based on logic and stylistics, which are usually considered marginal to the description of linguistic phenomena. ... A special focus in the present approach on parallel texts is directly connected with translation . ...
THE RUSSIAN STYLE OF CIVIL PROCEDURE Dmitry Maleshin Reprinted from Emory International Law Review Volume 21, No. ... 26 See id. ... Another exceptional feature of the Russian civil procedure is the original status of judicial precedent as a source of Russian civil procedural law. ... 98 See OSCAR G. CHASE, LAW , CULTURE, AND RITUAL: DISPUTING SYSTEMS IN CROSS-CULTURAL CONTEXT 53-55 (2005); JAMES ET AL., supra note 6, at 309-10; THOMAS MAIN, GLOBAL ISSUES IN CIVIL PROCEDURE 5 (2006); Oscar G. Chase. ...
Information Projects Detectors Staff Publications Contacts . ... Ahn H., Bashindzhagyan G.L., Kuznetsov E.N., Voronin A.G., et al ., ... April Meeting, Jointly Sponsored with the High Energy Astrophisics . Division (HEAD) of the American Astronomical Society, . April 20-23, Albuquerque , New Mexico , USA , Abstracts, . 2002, p . ... Gunasingha R., Bashindzhagyan G.L., Kuznetsov E.N., Voronin A.G., . ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... When embedded within a base document, a URL in its absolute form may contain a great deal of information which is already known from the context of that base document's retrieval, including the scheme, network location, and parts of the url-path. ... Introduction This document describes the syntax and semantics for "relative" Uniform Resource Locators (relative URLs): a compact representation of the location of a resource relative to an absolute base URL. ... 3.1) Base URL embedded in the | ...
... Graduate/PhD students as well as young specialists (including Post- Doc researchers) in the following areas: Material Science Semiconductors , RF, Electrical, and Electronic Engineering , Software Developing , Optical Engineering , and Fundamental Science are kindly welcome to participate in the Competition Application requirements: College/Graduate/PhD students, young specialists ... Science | ... Science |design, equipment design, chemical analysis, automation | ... Medal | ...
[
Текст
]
Ссылки http://www.msu.ru/science/details/2005/Competition_May2005.doc -- 56.0 Кб -- 12.05.2005 Похожие документы
... Multi-threaded search engines . ... Unfortunately, most documents on search engines I saw in the Internet were either lists of hyperlinks without any comments, or discussions about how many documents are in the database of ... (here is the name of a search engine) and what method of counting of the number of documents was used. No words about the efficiency, i.e. how many documents on some subject I can find using this search engine, especially in comparison with the other ones. ...
International Laser Center of MSU . ... Education . ... 06.10.2014 . October 10, 2014 . 15:00 S.A. Akhmanov Hall, KNO . ... 20.09.2009 . ... 15:00 S.A. Akhmanov Hall, Nonlinear Optics Bld. ... In our work we have obtained analytical expressions, which describe the distributions of intensity and polarization in the cross-section of a second-harmonic (SH) light beam. It is found that the polarization state drastically changes along the cross-section of the signal light beam. ...
... One can compare the positions of these singularities and their corresponding singular variables in the Feynman diagrams which contribute to the signal process under consideration, and to both reducible and irreducible backgrounds. ... For a standard analysis using cuts on variables, one should cut hard against the regions of singularities in the background singular variables while keeping the regions with singularities for the signal singular variables (see e.g. [8]). ...
... L Сd , Pol a nd ABOUT EFFECTIVE MODES METHOD FOR DESCRIPTION OF INTERNAL DYNAMICS OF WEAKLY BOUND CLUSTERS Elena Belega, Evgeny Cheremukhin 1 , Dmitry Trubnikov Abstract: New approach to describe the internal dynamics of weakly bound clusters is presented. ... It is found that the number of active collective modes depends on the initial cluster excitation and that the internal energy is partitioned nonuniformly among the modes. ... Collective motion of oxygen atoms performs mostly in plane. ...
[
Текст
]
Ссылки http://beams.chem.msu.ru/doc/Dynamical_systems_Theory_and_applications.pdf -- 148.8 Кб -- 12.10.2012 Похожие документы
... MARINE GEOLOGY Variability in the Condition of the Photosynthetic System of the Black Sea Phytoplankton S. I. Pogosyan and D. N. Matorin Department of Biology, Moscow State University, Moscow, Russia Received January 27, 2005 Abstract--An analysis of the results of long-term multidisciplinary studies of the photosynthetic system of the Black Sea ... The regularities in the influence of insolation and oxidation stress on the parameters of the chlorophyll fluorescence are shown. ...
МГУ имени М.В.Ломоносова Русская версия . ... About Conference . Structure of the conference . ... Biology . Asian and African Studies . ... Global Studies and geopolitics . ... Art Criticism and History . History and Art History . ... Social studies and modernity . ... Cultural studies. ... International Conference for Students and Young Scientists "Lomonosov" . ... 29 Feb 2016 . ... ABSTRACT TEMPLATE FOR BIOLOGY SECTION OF LOMONOSOV CONFERENCE - 2016 . ... МГУ имени М.В. Ломоносова . ...
Publications . General Information . ... For physics faculty . ... For natural faculties . ... At this page the list of all publications of members of the department is represented. ... List of publications for 1998 . List of publications for 1999 . List of publications for 2000 . List of publications for 2001 . Note: The publications is given in English only that publicated in anglo-language journals. ... Amount of publications in recent years: . ...
Вы посетили: teach_engl.html . ... История кафедры . ... Introduction to Algebra . Linear Algebra . Abstract Algebra . ... Ring Theory (together with Alexander V. Mikhalev and Victor T. Markov) . Matrix Theory and its Applications . ... Matrix Theory . staff/guterman/teach_engl.html.txt Последние изменения: 13.02.2013 11:26 (внешнее изменение) | ...
... Опубликовано Февраль 21, 2015 Март 6, 2016 Автор aislepkov . Mr WordPress : . Февраль 21, 2015 в 3:37 пп . Hi, this is a comment. To delete a comment, just log in and view the post's comments. ... Ваш e-mail не будет опубликован. ... E-mail * . ... Можно использовать следующие HTML -теги и атрибуты: <a href="" title=""> <abbr title=""> <acronym title=""> <b> <blockquote cite=""> <cite> <code> <del datetime=""> <em> <i> <q cite=""> <strike> <strong> . Сайт работает на WordPress ...