... List of complexes . List of structures of RNA-protein and DNA-protein complexes . ... Experimental method: all X-RAY DIFFRACTION SOLUTION NMR ELECTRON MICROSCOPY FIBER DIFFRACTION SOLUTION NMR; THEORETICAL MODEL SOLUTION NMR; SOLUTION SCATTERING . Kind: all rna dna hybrid . ... HYDROLASE/DNA . X-RAY DIFFRACTION . ... dna . ... RNA BINDING PROTEIN/RNA . ... rna . ... HYDROLASE/RNA/DNA . ... HYDROLASE/RNA . ... TRANSFERASE/RNA/DNA . ... TRANSFERASE/DNA/RNA . ... NPIDB team 2003 - 2016 . ...

Еще в разделе: (Показать все результаты (>6) - npidb.belozersky.msu.ru/ )

... Awards and Prizes . ... Home Research Awards and Prizes . Scholarships of Lomonosov Moscow State University for PhD students and young scientists: . Alexey L. Voskov . ... Awards of XIX International Conference on Chemical Thermodynamics in Russia RCCT?2013 (5 of 16): . ... Ilya Pentin, Alexey Voskov (2005) . ... Awards of Moscow government in 2005: . ... Colloquium on 24.12.12 20 Dec 2012 . ... Laboratory of Chemical Thermodynamics . ... 2000-2016 Laboratory of Chemical Thermodynamics . ...

Еще в разделе: (Показать все результаты (>8) - td.chem.msu.ru/ )

PTOLEMY'S FAILINGS . ... The Crime of Claudius Ptolemy. ... Almost as a stocktaking of Ptolemy , the 1970s saw the publication of three monographic writings on his astronomy , viz, O. Neugebauer's authoritative account of the contents of the Almagest in its context of the mathematical side of the rest of ancient astronomy , 1 O. Pedersen's Almagest companion volume designed to guide also the student of Latin astronomy up to the Renaissance, 2 and R. R. Newton's ...

Еще в разделе: (Показать все результаты (>84) - hbar.phys.msu.ru/ )

... My field of specialization is Stability Theory, Nonlinear Dynamics, Asymptotic Methods, Mechanics of Solids, System Identification, Optimal Control, Economic Growth. ... A.O. Belyakov and A.P. Seyranian (2012). ... A.O. Belyakov and A.P. Seyranian, . ... A.P. Seyranian and A.O. Belyakov, Swing dynamics. ... A.O. Belyakov, A.P. Seyranian, and A. Luongo, Regular and chaotic dynamics of the swing. 6th EUROMECH Nonlinear Dynamics Conference (ENOC 2008) , Saint Petersburg, Russia, June, 30 - July, 4 2008...

Еще в разделе: (Показать все результаты (>8) - belyakov.imec.msu.ru/ )

ChangeLog for tanchiki # # Generated by Trac 0.12.5 # 04/11/16 23:02:23 Mon, 20 Dec 2010 05:15:19 GMT Peter Zotov <whitequark@тАж> [21:fe5df803d6c2] * tanchiki/body.py (modified) * tanchiki/controller.py (added) * tanchiki/game.py (modified) * tanchiki/user_controller.py (added) Split UserController and Controller classes. Mon, 20 Dec 2010 05:08:18 GMT Peter Zotov <whitequark@тАж> [20:ee776b889df7] * tanchiki/game.py (modified) Improve Game interface. ...

Еще в разделе: (Показать все результаты (>1392) - kodomo.cmm.msu.su/ )

• http://kodomo.cmm.msu.su/trac/cca/log/?format=changelog&rev=0865e29e319df9486ce64a2b5e28808a54c6ca12&stop_rev=99%3A33fea6b97cd3&limit=100&mode=stop_on_copy
• http://kodomo.cmm.msu.su/trac/cca/log/?format=changelog&rev=0865e29e319df9486ce64a2b5e28808a54c6ca12&stop_rev=b3fb9595fee7ccf4db04b4f448092fa94188ed82&limit=100&mode=stop_on_copy
• http://kodomo.cmm.msu.su/trac/cca/log/?format=changelog&rev=0865e29e319df9486ce64a2b5e28808a54c6ca12&stop_rev=33fea6b97cd34ca033da0bd43c72c37ae5967579&limit=100&mode=stop_on_copy

... opt/atlas/12.0.8/cmtsite/setup.sh -tag=<release>[,<mode>] # # projects # . opt / atlas / 12.0.8 / cmtsite /setup.sh -tag= project , release [, mode ] # # Report bugs to hn- atlas -releaseKitProblem@cern.ch , atlas -sw-installation@cern.ch . # set CMTSITE STANDALONE set SITEROOT / opt / atlas / 12.0.8 macro ATLAS_DIST_AREA ${ SITEROOT } # use optimised version by default apply_tag opt apply_tag setup apply_tag projectArea ...

Еще в разделе: (Показать все результаты (>2) - lhe.sinp.msu.ru/ )

... О проекте . ... A specialized source of quasi-?monochromatic X-?ray radiation for medical application is proposed. It includes two electron storage rings (E = 50 MeV) placed in the vertical plane and two laser resonators located in the horizontal and vertical planes. Hard X rays are generated in a process of back Compton scattering of laser photons ~1eV by electrons in the linear paths of storage rings. ...

Еще в разделе: (Показать все результаты (>7) - miles.sinp.msu.ru/ )

• Proposal of a Compact Repetitive Dichromatic X-ray Generator with Millisecond

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>9) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/megablast.out

The file a_news.php had been edited by : IP: 193.232.121.99 Time: 22.12.2008|12:28:34 This message had been generated by http://www.web2ftp.com On abuse issues, please contact abuse@web2ftp.com

230. The Laboratory of chemistry and physics of sensor and semiconductor materials |

231. http://dist.ffl.msu.ru/cdo/conf0606/confaneng.doc

232. Конференции по реконфигурируемым системам

233. VaST homepage

---

Астронет | Научная сеть | ГАИШ МГУ | Поиск по МГУ | О проекте | Авторам

Комментарии, вопросы? Пишите: info@astronet.ru или сюда