... Квантовая теория . ... Непертурбативная низкоэнергетическая физика адронов и лептонов (руководители - проф. К.А.Свешников, проф. А.Е.Дорохов). ... Методы квантовой теории поля в физике конденсированного состояния (руководители - с.н.с. О.В.Павловский, с.н.с. М.В.Улыбышев). Кафедра активно участвует в организации и проведении ежегодных международных семинаров по проблемам квантовой теории поля и теории гравитации в ИФВЭ - Протвино. ... Phys. Rev. D 85 (2012) 094022, arXiv: 1110.6059. ...

Еще в разделе: (Показать все результаты (>2) - hep.phys.msu.ru/ )

... The Semantic Dictionary RUSLAN-1, the last version being Russian-to-English direction, is a tool for semantic and informational analysis of any coherent Russian text. The rich semantic information contained in the dictionary makes possible local, within one phrase, semantic interpretation as well as semantic analysis of coherent texts. ... Text understanding is very closely related to information analysis (Leontyeva 2000). ... We therefore call it "relative understanding". ...

Еще в разделе: (Показать все результаты (>5) - leontyeva.srcc.msu.ru/ )

• Lexical Resources for Personal Data Recognition in Texts
• Semantic Resources for Textual Content Compression

... One of the project objectives was to investigate practical efficiency of some modern iterative methods, including multigrid techniques and domain decomposition methods as well as methods for small compressible materials. ... Hence, the project research initiated because of INTAS financial support contributes in setting up modern computational techniques in tire design. ... Research on efficiency of iterative methods was conducted at the department of Mechanics of Composites about ten years ago. ...

Еще в разделе: (Показать все результаты (>4) - composite.msu.ru/ )

• Department of the Composites Mechanics
• Pobedria Boris Efimovich

Russian TeX Disk . ... Please, use "Save link as" (right mouse button) for downloading files, otherwise binary files will be corrupted. What is russian TeX disk . ... Some TeX versions and tools are installed/russified and can be started directly from CD; other are only distributives plus additional files for their russification. ... FPTEX . ... Directory russian.add: Generic files (mf-sources, pfb-fonts and hyphen file) for russification of any-TeX-realizations in: . ... file readme: . ...

Еще в разделе: (Показать все результаты (>3) - tex.bog.msu.ru/ )

... Научный календарь МГУ Научная жизнь на ФГУ Конференции Научные семинары Международная конференция ФГУ International Conference Молодым ученым Электронные ресурсы Список полнотекстовых баз данных (журналы) Список полнотекстовых баз данных (книги) Список реферативных баз данных Материалы международных конференций Архив мероприятий Конференции Научные семинары Круглые столы Презентации Международная конференция ФГУ Фестиваль науки Международное сотрудничество . ... Теория и методология управления . ...

Еще в разделе: (Показать все результаты (>28) - www.spa.msu.ru/ )

... Science Park . ... Agency for networking, information and communication technologies ( NETINFOKOM LLC) ank-nic@rambler.ru http://www.msunews.ru/ . ... Developing the infrastructure and information support needed for projects that provide an interdisciplinary exchange of science information and the potential for collective work on the base of network services and technologies. ... The company has a great deal of experience in the design, development and penetration of laboratory information systems. ...

Еще в разделе: (Показать все результаты (>4) - www.sciencepark.ru/ )

January 2012 EPL, 97 (2012) 26003 doi: 10.1209/0295-5075/97/26003 www.epljournal.org Elastic instability and contact angles on hydrophobic surfaces with p erio dic textures A. L. Dubov 1 1, 2 , J. Teisseire1 and E. Barthel 1 Surface du Verre et Interfaces, UMR 125 CNRS/Saint-Gobain - 39, quai Lucien Lefranc, F-93303 Aubervil liers, Cedex, France, EU 2 A.N. Frumkin ... Finally for an advancing triple line the work of adhesion is (1 + cos adv 1 ~ (l/d)2 =k . ...

Еще в разделе: (Показать все результаты (>31) - nanofluidics.phys.msu.ru/ )

• http://nanofluidics.phys.msu.ru/paper/jcp2012_2.pdf
• http://nanofluidics.phys.msu.ru/paper/Mendeleev-2012.pdf
• http://nanofluidics.phys.msu.ru/paper/JCP2014-2.pdf

... Research . ... Linguistic expeditions . ... Up to now the subjects to documentation were local dialects of Selkup, Ket, and Evenki. ... 1) creation and enlargement of multimedia computer archives of Selkup, Ket, and Evenki speech, which include sounding dictionaries and folklore texts and life-stories in audio, video, and graphic representation in local dialects of the surveyed villages; development of linguistic multimedia databases; . ... 8) research into the Selkup-Ket-Evenki language contacts; ....

Еще в разделе: (Показать все результаты (>13) - lcl.srcc.msu.ru/ )

... On-line консультант . ... Место работы, должность: Преподаватель, старший научный сотрудник Лаборатории Вычислительных комплексов ВМК МГУ имени М.В.Ломоносова . ... D. Gamayunov, R. Smeliansky. ... 2002. (in Russian) . D. Gamayunov, A. Kachalin. ... In proceedings of the fifth Russian Applied and . ... detectors of computer attacks for corporate networks. ... I. Bulgakov, D. Gamayunov, E. Toroschin, Detecting network worms . ... Опыт работы по тематике магистратуры: 9 лет (руководство . ...

Еще в разделе: (Показать все результаты (>7) - erp.cmc.msu.ru/ )

... Scientific Effort . ... Cosmic ray astrophysics . Space Physics . ... Nuclear physics . ... The paper was prepared with contributions from Elena Popova from the Skobeltsyn Institute of Nuclear Physics (Lomonosov Moscow State University) and was published in Scientific Reports. ... Federal State Budget Educational Institution of Higher Education M.V.Lomonosov Moscow State University, Skobeltsyn Institute of Nuclear Physics (SINP MSU), 1(2), Leninskie gory, GSP-1, Moscow 119991, Russian Federation . ...

Еще в разделе: (Показать все результаты (>3) - sinp.msu.ru/ )

... For the past years I have been working on the problem of synthesis of light curves of close binary systems, consisting of a normal star and a compact object (point object with fixed X-ray luminosity). ... Possible existence of a bright spot on the disk's lateral surface is taken into account. ... The last of then will be published in Gordon and Breach Publishers ( Cherepashchuk A.M., Katysheva N.A., Khruzina T.S., Shugarov S.Yu. ... Cherepashchuk A.M., Katysheva N.A., Khruzina T.S., Shugarov S.Yu. ...

Еще в разделе: (Показать все результаты (>18) - uranus.sai.msu.ru/ )

• Публикации Ильи Лившица
• Nikolay Bochkarev

... The applied mathematics (with Honors), Kazan State University, Kazan, Russia (USSR), 1980. nd Alexander Lazarev Research Interests Discrete optimization: combinatory problems, modeling, decomposition algorithms, applications to production planning and scheduling. ... Kazan, Publishing house of the Kazan mathematical society, 1998. - 285 p. Lazarev A.A., Gafarov E.R. Scheduling Theory. ... Computer centre of the Russian Academy of Sciences - 2006. - 134 p. Lazarev A.A., Gafarov E.R. Scheduling Theory...

Еще в разделе: (Показать все результаты (>2) - physcontrol.phys.msu.ru/ )

... 35, No. 2, pp. 87­99. i Star Formation History in the Central Region of the Barred Galaxy NGC 4245 O. K. Sil'chenko1* , I. V. Chilingarian1, 2 , and V. L. Afanasiev 1 2 3 Sternberg Astronomical Institute, Universitetskii pr. ... The galaxy has been found to possess a pronounced chemically decoupled compact stellar nucleus, which is at least a factor of 2.5 richer in metals than the stellar population of the bulge, and a ring of young stars with a radius of 300 pc. ... NGC 4245. ...

Еще в разделе: (Показать все результаты (>46) - sn.sai.msu.ru/ )

• MPFS reduction routines HELP

Special courses for the students of Physics Faculty, specialized at the Department. ... 32 hours, 6-th term . ... A review of characteristic ferroelectric and magnetic materials is given. ... The anomalies of physical properties in the phase transition in accordance with the crystal symmetry. ... Solid state physics . ... It is assumed that student will get knowledge about magnetic properties of such systems as molecular, clusters, nano-particles, surfaces, ultra thin films, mono- and multilayers. ...

Еще в разделе: (Показать все результаты (>6) - ferro.phys.msu.ru/ )

... for Food Security . Home Events Online Consultation on Network and Partnerships.. ... This discussion will serve as a preparatory stage for the upcoming International Conference on International Conference on Eurasian Food Security and Nutrition Network and Eurasian Soil Partnership to be held in Bishkek, February 29-March 2, 2016. ... Topic 1: Building the Eurasian Food Security Network . ... International Forum on Eurasian Food Security and Nutrition Network and Eurasian Soil Partnership read . ...

Еще в разделе: (Показать все результаты (>13) - ecfs.msu.ru/ )

... О кафедре . ... Главная Наши сотрудники Голубцов Петр Викторович . ... 2 г. Москвы поступил на физический факультет МГУ им. М. В. Ломоносова. По окончании физического факультета в 1983 году поступил на работу на кафедру математики. ... С 2001 года П. В. Голубцов работает на кафедре математики в должности профессора. ... В 1995 году П.В. Голубцов был отмечен премией конкурса молодых преподавателей физического факультета МГУ. ... Кафедра математики физического факультета МГУ им. М.В. Ломоносова . ...

Еще в разделе: (Показать все результаты (>7) - matematika.phys.msu.ru/ )

ISSN 0026-2617, Microbiology, 2008, Vol. ... Key words: late stationary phase, secondary growth, Pseudomonas aeruginosa, S and M dissociants, population structure of the culture. ... Growth dynamics and population composition of a mixed culture of P. aeruginosa S and M dissociants in the variant of autolysis in the late stationary phase: optical density, OD з 100 (1); ratio of the M dissociant in the population, % (2); pH (3); and content of reducing sugars, mg % (as glucose) (4). ...

Еще в разделе: (Показать все результаты (>20) - dis.bio.msu.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>6) - mouse.genebee.msu.ru/ )

. QM/MM approach is applied to modelling of GTP hydrolysis reaction mechanism. We use X-ray structure as initial atom coordinates for QM/MM calculations. We consider 2 systems: free EF-Tu and complex with ribosome.

Еще в разделе: (Показать все результаты (>6) - lcc.chem.msu.ru/ )

• CV of Alexander Moskovsky

... Also, if events can be split up into distinct but overlapping events, how do you approximate the fluences of the individual events? ... In any cases, You can observe new increasing the E>30 MeV fluxes after first event. ... And for that case, what should be difference in fluences, predicted by different models. ... Fig. ... For different SEP model characteristics were used different events sets. 183 were physical events, what were used for development of the regularities, inherent to the SEP events....

Еще в разделе: (Показать все результаты (>8) - srd.sinp.msu.ru/ )

• http://srd.sinp.msu.ru/nymmik/models/hilgers.pdf
• Rikho Nymmik