Chemistry of Heterocyclic Compounds, Vol. ... 8, 1995 INSTRUCTIONAL TECHNIQUE IN HETEROCYCLIC CHEMISTRY COMPUTER ANIMATION: A NEW METHOD AND REPRESENTATION IN HETEROCYCLIC FOR TEACHING, OF KNOWLEDGE COMMUNICATION, ABOUT REACTIONS CHEMISTRY E. V. Babaev We propose the use of computer animation techniques .for representation of knowledge about organic reactions, in particular as applied to syntheses and transformations of heterocTcles. ... Let us briefly consider the capabilities of this program. ...

Еще в разделе: (Показать все результаты (>147) - www.chem.msu.ru/ )

• Mathematical Chemistry
• Intuitive Chemical Topology Concepts

... Multi-threaded search engines . ... Unfortunately, most documents on search engines I saw in the Internet were either lists of hyperlinks without any comments, or discussions about how many documents are in the database of ... (here is the name of a search engine) and what method of counting of the number of documents was used. No words about the efficiency, i.e. how many documents on some subject I can find using this search engine, especially in comparison with the other ones. ...

Еще в разделе: (Показать все результаты (>3) - scon155.phys.msu.ru/ )

• Database: publications on x-ray absorption spectroscopy

... 2 What is MATLAB ?? Basic Matrix Operations Script Files and M-files Some more Operations and Functions APPLICATIONS: Plotting functions .. ... Vectors are special forms of matrices and contain only one row OR one column. Scalars are matrices with only one row AND one column MATLAB Matrices 17 A matrix with only one row AND one column is a scalar. A scalar can be created in MATLAB as follows: ? a_value=23 a_value = 23 MATLAB Matrices 18 A matrix with only one row is called a row vector. ...

Еще в разделе: (Показать все результаты (>18) - imaging.cs.msu.ru/ )

• http://imaging.cs.msu.su/~yurin/2008.astr.Yurin_Kravtsov.script.ru.pdf
• http://imaging.cs.msu.ru/pub/2013.PRIA.Levashov_Yurin.RidgeAndTree.en.pdf
• http://imaging.cs.msu.su/pub/2010.DSPA.Chernomorets_Nasonov_Krylov.BlinkEEG.en.pdf

Name Last modified Size Description . Parent Directory - _vti_cnf/ 30-Oct-2012 12:19 - filelist.xml 26-Nov-2003 00:39 163 image001.gif 26-Nov-2003 00:39 5.3K . Apache Server at genphys.phys.msu.su Port 80

Еще в разделе: (Показать все результаты (>44) - genphys.phys.msu.su/ )

• Index of /rus/edu/kvant/II_2/STAT2/_private/Statistic.files/_vti_cnf
• Index of /rus/edu/kvant/II_2/STAT2/_private

Sergey A. Ayvazyan Methods of Econometrics Introduction Dear reader, You have a textbook in your hands on methods of econometrics, one of the three basic disciplines of higher economic learning, along with micro- and macroeconomics. In Russia, unfortunately, the status of econometrics was recognized belatedly: econometrics was introduced into the study programs of economic learning in several leading Russian higher educational institutions only since 1992. ...

Еще в разделе: (Показать все результаты (>23) - www.mse-msu.ru/ )

• http://www.mse-msu.ru/CV_perakki.pdf
• http://www.mse-msu.ru/CV_Edoardo_Reviglio.pdf
• http://www.mse-msu.ru/Maevsky,%20Zorin%20-%20Managed%20monetary%20accelerator.pdf

Site navigation: . ... Publications . ... SPDC Laboratory . Quantum Electronics Chair . ... Error: You currently have Javascript disabled. This website uses Javascript for many elements such as the menus and page customization. ... Currently the following downloads formats are supported by one or the other publication: . ... Compressed versions of the PostScript files. ... Links towards the Digital Object Identifier pages, . ... Links to the publication's or the author's homepages. ...

Еще в разделе: (Показать все результаты (>133) - qi.phys.msu.ru/ )

• Directions :: Quantum Information Laboratory

hpc@cmc . ... Blue Gene/P . ... Tesla CMC . ... Регистрация . ... Серия Blue Gene в мире . ... VPN-подключение . ... В данном разделе описывается подключение к VPN факультета в ОС GNU/Linux с помощью графического интерфейса, предоставляемого программой KNetworkManager на примере ОС openSUSE 11.2 x86-64. Кликните левой кнопкой мыши по иконке программы KNetworkManager в системном трее и выберете пункт Manage connections : . ... Введите желаемое имя соединения в поле Connection name (например, CMC ). ...

Еще в разделе: (Показать все результаты (>3) - hpc.cmc.msu.ru/ )

• VPN-подключение

... Binding of ouabain and marinobufagenin leads to different structural changes in Na,K-ATPase and depends on the enzyme conformation. ... We have shown that both CTS inhibit activity of Na,K-ATPase with the same Ki values, but binding of ouabain is sensitive to the conformation of Na,K-ATPase while binding of marinobufagenin is not. Furthermore, binding of ouabain and marinobufagenin results in different structural changes in Na,K-ATPase. ...

Еще в разделе: (Показать все результаты (>103) - biochem.bio.msu.ru/ )

• Structural basis for regulation of stability and activity in
• Biochemistry Department of Moscow State University | Regulation of muscle
• Biochemistry Department of Moscow State University | Mechanism of mitochondria

... Veselovsky, V.A., Djanumov D.A. The use of biophysical methods in the study of adaptive reactions of plants, in connection with the problem of resistance. ... Kulaeva, O.N., Mikulovich T.P., Veselova, T.V., Veselovsky, V.A., Kukina, I.M., Klyueva N.Yu. ... Veselovsky, V.A., Veselova T.V . ... Nauka, Moscow (in Russian).1990. 200 p. Veselova T.V., Veselovsky V.A., Chernavsky D.S. Stress of Plant: A Biophysical Approach. ... Veselova T.V., Veselovsky V.A. Photosynthesis and stress of plant cells. ...

Еще в разделе: (Показать все результаты (>6) - biophys.msu.ru/ )

Lomonosov Moscow State University Biological faculty Botanical garden (Russia) (http://botsad.msu.ru/eng_news.htm) Botanical garden of the Komarov Botanical institute (Russia) Russian Iris Society Botanical garden of Taurida National Vernadsky University (Ukraine) The second information message Dear colleagues! ... Educational and enlightening activities based on collections of genus Iris L. The program of the Symposium will consist of plenary and sectional sessions as well as poster presentations. ...

Еще в разделе: (Показать все результаты (>11) - botsad.msu.ru/ )

• Botanical garden of Lomonosov Moscow State University

... IM2, c (2222430 nt) initn: 382 init1: 382 opt : 402 Z-score: 427.8 bits : 96.2 E(75): 3.7e-20 banded Smith-Waterman score: 402; 64.1% identity (64.1% similar) in 234 nt overlap (68- 300 :1090800-1091033) 40 50 60 70 80 90 NC_000 TAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTC-CGT :: : ::: :::: :: :: :: :: AE0094 AAGAGCCCGGCTTTTGCCCGGTCTAAAACGCCGGGCGAATAAGCGGGGGGCAAGTCTGGT 1090770 1090780 1090790 1090800 1090810 1090820 100 110 120 130 140 150 ...

Еще в разделе: (Показать все результаты (>12) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out
• Nhunt: program for nucleic acid sequence similarity search

... O ur international collaboration traces back to early 1990's when it became possible in Russia to maintain the links directly between Eastern and Western scientific groups. ... Professor Ole Keller and Professor Kjeld Pedersen from Institute of Physics of Aalborg University, Aalborg, Denmark. ... Professor Mike Downer from Department of Physics, The University of Texas at Austin, Austin, Texas, USA. ... Dr. J. Hlinka from Institute of Physics, Czech Academy of Science, Prague, Czech Republic. ...

Еще в разделе: (Показать все результаты (>36) - shg.phys.msu.ru/ )

• Milestones of the lab highway

Lomonosov project . ... Mikhail Lomonosov . Scientific goals . ... Scientific equipment . ... BDRG . ... DEPRON . ELFIN-L . ... The satellite ?Mikhailo Lomonosov? is based on the platform of the spacecraft ?Kanopus-B? developed by the All-Russia reasearch and development institute of electromechanics named after Iosiphyan (VNIIEM). ... Scientific equipment will weight about 120 kg, while the total weight of the satellite will be about 450 kg. ...

Еще в разделе: (Показать все результаты (>22) - lomonosov.sinp.msu.ru/ )

. Home . Structure of Data . Description . Catalog . Publications . VO . ЮБ 2000 . 11:14:20.2 . ЮД 2000 . -57:33:04 . l . 290.172 . b . 2.895 . diameter . 14.0' . (m - M) 0 . 11.4 0.05 . distance . 1900 50 pc . E(B - V) . 0.08 0.01 . log(t) . 9.65 0.05 . (J, J-H) isochrone VOTable . 2MASS data VOTable . Developed by the Team . Send us your questions or feedback

Еще в разделе: (Показать все результаты (>210) - ocl.sai.msu.ru/ )

• SAI OCL Catalog Berkeley 53
• SAI OCL Catalog Berkeley 71
• SAI OCL Catalog Berkeley 72

RUSSIAN version . ... Vladimir V. SHAKHPARONOV . ... Since 2008 works as a researcher in the Department of Vertebrate Zoology of the Faculty of Biology MSU. ... At present I work at my Ph.D thesis 'Spatial orientation of amphibians belonging to terrestrial and semiaquatic ecological groups' (scientific supervisor - assoc. prof. Sergei V. Ogurtsov ). ... August 12-16, 2003, St. Petersburg, Russian Journal of Herpetology, 12(Suppl.), pp.209-212. [download pdf-file] . ...

Еще в разделе: (Показать все результаты (>58) - vertebrata.bio.msu.ru/ )

• Sergei V. Ogurtsov

... Отмеченная наградами АстроТоп-а . ... Анатолий Анатольевич Волчков . ... кто-то из великих) Я долго подбирал название для этой мемориальной статьи об Анатолии Анатольевиче Волчкове. ... Какие только названия не приходили ко мне в голову - "Легенда об Анатолии", "Исполнить миссию", "Человеко-форум", "Камертон Астрорунета".. ... P.P.S. 31 декабря 2003 г. решением команды проекта Астротоп принято решение - "признать Анатолия Волчкова Человеком года " в традиционных конкурсах Звезды АстроРунета-2003 . ...

Еще в разделе: (Показать все результаты (>8) - www.astrotop.ru/ )

... 2.2 A d-graph . ... of external monads . ... The addition of one x-structure is called an elementary extension. ... If this elementary extension generates several loops with the set {Xa } of start (finish) x-structures, then the set of monads of one kind (the creation or the annihilation) that belong to {Xa } is a antichain. ... If the next external elementary extension appears close ~ by the first we have two new growing sequences of L. This structure describes the collision of two minimons. ...

Еще в разделе: (Показать все результаты (>16) - temporology.bio.msu.ru/ )

• http://temporology.bio.msu.ru/EREPORTS/krugly_discrete.pdf
• http://temporology.bio.msu.ru/EREPORTS/korotaev_experimental.pdf
• http://temporology.bio.msu.ru/EREPORTS/krugly_discreet-mechanics.pdf

Lessons learned from the Thirty Meter Telescope site testing Tony Travouillon Sebastian Els, Angel Otarola, Reed Riddle, Matthias Schoeck, Warren Skidmore TMT.XXX.PRE.05.0XX.DRF01 1 Introduction TMT and its Site testing. Important choice before going on site. ... Considerations during analysis of the data. TMT.XXX.PRE.05.0XX.DRF01 2 Some Background about the TMT Site Testing TMT is a 30m, segmented, RitcheyChretien telescope design. ... ASCA Cloud Cover Analysis So how do we do it in practice? ...

Еще в разделе: (Показать все результаты (>21) - site2010.sai.msu.ru/ )

• Methods and instruments to measure/monitor major site properties

... Совместный проект Центра Гельмгольца с Российским Фондом Фундаментальных Исследований DETI.2 (HRJRG-314 & RFBR #12-02-91321-SIG_a"): . ... Отчет за первый год проекта (English); список публикаций за первый год проекта ; список оборудования, приобретенного за первый год проекта . ... This work is supported by the Initiative and Networking Fund of the German Helmholtz Association, Helmholtz-Russia Joint Research Group HRJRG-314, and the Russian Foundation for Basic Research, RFBR #12-02-91321-SIG_a" ....

Еще в разделе: (Показать все результаты (>18) - magn.phys.msu.ru/ )

. If you see this page, the nginx web server is successfully installed and working on Debian. Further configuration is required. For online documentation and support please refer to nginx.org . Please use the reportbug tool to report bugs in the nginx package with Debian. However, check existing bug reports before reporting a new bug. Thank you for using debian and nginx.