... Кафедра нелинейных динамических систем . ... В понедельник, 11 апреля 2016 г., в 18 ч 20 мин, в ауд. 707 состоится очередное заседание семинара. ... Автор: Фурсов Андрей Серафимович 09.04.2016 . В понедельник, 28 марта 2016 г., в 18 ч 20 мин, в ауд. 707 состоится очередное заседание семинара. ... Сотрудники кафедры НДСиПУ, участвующие в 2016 г. в экзаменационной комиссии - Боресков А.В., Краев А.В., Бобылева О.Н., Гончаров О.И., Капалин И.В. Автор: Фурсов Андрей Серафимович 22.02.2016 . ...
LUT Summer School: www.lut.fi/summerschool summerschool@lut.fi Guide for Student Advisers Greetings from your colleagues at Lappeenranta University of Technology! ... With the wide-ranging selection of courses on-offer during the LUT Summer School we aim to both challenge and inspire students. ... Lappeenranta and LUT Lappeenranta is located some 220 km northeast of Finland's capital, and about 230 km northwest of St. Petersburg, Russia. ... The fee will be given on the LUT Summer School web pages. ...
[
Текст
]
Ссылки http://www.phys.msu.ru/rus/about/structure/admin/OTDEL-FOREIGN/INVITATIONS/LUT_Summer_School_2013_staff.pdf -- 448.5 Кб -- 17.01.2013 Похожие документы
... The characteristics of the materials we have selected, the procedure of winding the optic fibers and the coating process are described in detail. ... The `passive' inner cylinder, shown in the left part of the picture, was machined from an anticorodal aluminum rod while the conical part is used to lead the optic fibers from the coils down to the axis of the hydrophone. ... 6: The sensor after the coating process: the hydrophone (right) and the box --7-- containing the two fiber Bragg gratings. ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
Apache2 Ubuntu Default Page . It works! This is the default welcome page used to test the correct operation of the Apache2 server after installation on Ubuntu systems. ... Ubuntu's Apache2 default configuration is different from the upstream default configuration, and split into several files optimized for interaction with Ubuntu tools. ... The configuration layout for an Apache2 web server installation on Ubuntu systems is as follows: /etc/apache2/ |-- apache2.conf | ... Document Roots . ...
Head of sector, acting head of the Computational Geophysics Division of the M.V. Keldysh Institute for Applied Mathematics, RAS. ... Finished the Electrodynamics and Quantum Theory Department of Faculty of Physics, MSU in 1962. ... Ill-posed problems, stochastic processes, theory of approximation. Mechanics and physics of multi-phase media, phenomena in porous media, difference schemes for some classes of mathematical physics problems (filtration, elasticity theory). ...
... Next Routine] [List of Routines] NAME: ADD_HEADER PURPOSE: addition information from FITS-headers MPFS-frames DESCRIPTION: The function computes the total exposure, mean value zenit distance and modified FITS header CALLING SEQUENCE: Result =ADD_HEADER( headers ) CATEGORY: reduction MPFS-data INPUTS: Headers = String array FITS-headers from the MPFS data OUTPUTS: Header = String array containing the header from the FITS file. ... OPTIONAL INPUT KEYWORD PARAMETERS: BEFORE = Keyword string name. ...
. NON-STATIONARY OPERATION OF THE FAST-FLOW LASERS . AND NEW POSSIBILITIES OF CONTROLLING THE LASER OUTPUT CHARACTERISTICS . A.V. Mushenkov, A.Yu.Loskutov, A.I.Odintsov, A.I.Fedoseev and V.F.Sharkov . Physics department of M.V.Lomonosov Moscow State University, 119899, Vorob'evy gory, Moscow, Russia . Abstract . The dynamics of the lasing of the fast crossflow gas laser with the inhomogeneous steady state pumping in the unstable resonator by means of numerical modeling is investigated. Depending on the
... Vol. ... Translated from Biofizika; Vol. ... CELL BIOPHYSICS Effects of Electric Field on Spatiotemporal Patterning in the Reaction-Diffusion System A. I. Lobanov-, T. Yu. ... Abstract-A model is proposed that describes electrodiffusion in the layer adjacent to the cell membrane. The model takes into account chemical reactions at the membrane, Coulomb interactions between particles, their random motion (diffusion), and the effect of an external electric field. ... BIOPHYSICS Vol. ...
Irena Lasiecka ( University of Virginia ) . Nikolai Melnikov (CEMI / MSU) . Mikhail Zelikin (MSU / Steklov Institute) . G. Avalos ( University of Nebraska , USA ) . V. Borisov (MSU, Moscow) . ... O. Emanouvilov ( Colorado State University , USA ) . A. Fursikov (MSU, Moscow) S. Hansen ( Iowa State University , USA ) R. Hildebrand ( Joseph Fourier University , France) V. Komornik ( University of Strassburg, France ) A. Kowalewski ( Institute of Automatics, Poland ) . ... Moscow) . ...
... 433-438 IMPRINTING ON NATIVE POND ODOUR IN THE POOL FROG, RANA LESSONAE CAM. ... To reveal the natural reaction of wild individuals of the pool frog to native pond water frogs (Group 1) were caught near their native pond at the end of metamorphosis, on stages 43-46 (Gosner, 1960), and were tested in a chamber 76 cm long, 12 cm wide and 15 cm high, made of white plastic and covered with a transparent glass. ... In tests wild frogs of Group 1 were offered native pond water paired with tap water. ...
[
Текст
]
Ссылки http://vertebrata.bio.msu.ru/Imprinting_on_native_pond_odour_in_the_pool_frog.pdf -- 123.4 Кб -- 08.02.2010 Похожие документы
... Academic Programmes . ... Vestnik CIE (in Russian) . ... Elective Courses . ... The XIX century Russian Literature; . ... Open to all interested students, this course is especially useful for those who are preparing for Certificate examination (upper levels), or engaged in translation and interpreting; for teachers of Russian as a foreign language. The course s ultimate goal is to build a diversified set of skills that will enable students to explore various genres of Russian Media independently. ...
Заведующий кафедрой Head of the Chair . ... История кафедры . ... В 1966 г. для расширения ведущихся на кафедре научных работ в НИИ Ядерной физики МГУ был создан отдел физики плазмы (ОФП), в 1989 году переименованный в отдел микроэлектроники (ОМЭ). ... Сегодня по различным научным направлениям, ведущимся по специальностям, преподаваемым на кафедре атомной физики, физики плазмы и микроэлектроники, работает около 100 научных сотрудников, среди которых 12 докторов наук и около 50 кандидатов наук. ...
Revised: 21 May 2014, Accepted: 27 May 2014, Published online in Wiley Online Library (wileyonlinelibrary.com) DOI: 10.1002/jmr.2399 Force -induced globule-coil transition in laminin binding protein and its role for viral- cell membrane fusion Boris N. Zaitseva, Fabrizio Benedettib,e, Andrey G. Mikhaylovb, Denis V. Korneeva, Sergey K. Sekatskiib*, Tanya Karakouzb, Pavel ... 2008, 2010). ... This should permit us to elucidate still unclear aspects of viral-cell membrane interaction and fusion. ...
[
Текст
]
Ссылки http://cell.biophys.msu.ru/static/announce/media/files/Force-induced_globule-coil_transition_in_laminin_binding_protein_and_its_role_for_viral-cell_membrane_fusion.pdf -- 1182.2 Кб -- 30.11.2015 Похожие документы
... An approach to the hybrid quantum mechanical and molecular mechanical (QM/MM) theory based on the effective fragment potential (EFP) technique (M. Gordon and co-authors) for modeling properties and reactivity of large molecular systems of biochemical significance is being developed. Currently we are preparing a novel version of the computer program based on the most recent variant of the PC GAMESS quantum chemistry package (A. A. Granovsky) and the TINKER molecular modeling package (J. Ponder). ...
... The Informativeness of Coherence Analysis in EEG Studies A. P. Kulaichev UDC 612.821.6 Translated from Zhurnal Vysshei Nervnoi Deyatel'nosti imeni I. P. Pavlova, Vol. ... KEY WORDS: coherence, spectral analysis, EEG non-stationarity, amplitude modulation. ... In particular, the two fundamental differences between EEG signals and most other physical signals are not considered: a) fundamental non-stationarity; b) amplitude modulation at all frequency ranges. ... Coherence in technical addenda. ...
... The students of the Faculty of Geography study territorial distribution and spatial development patterns of various natural phenomena as well as social and economic objects. ... The academic program includes courses with lectures, seminars, laboratory and field training in natural sciences and humanities which form 4 blocks: . ... In addition to the field stations of the Faculty, the students have an opportunity to have their field training in scientific institutions and different companies. ...
Stephen Price (Southampton U) Q: The difference of theoretical and experimental patterns is rather high, why? The difference between the experimental and theoretical patterns is large in the case of the Cu and Pd EXAFS because only the first nearest neighbour shell is fit, that only the atoms within 3 е of the absorber. In contrast, the Au EXAFS is fit up to 6 е and so the theoretical and experimental patterns is much less. ... Q: What was the technology of underpotential deposition? ...
... Инструкция по работе с информационными ресурсами в ОРОКС . ... Основные разделы сервера: Выбор раздела сервера ------------------------------------ На первую страницу "ChemNet" ------------------------------------ Химический факультет МГУ ------------------------------------ Электронная библиотека по химии ------------------------------------ Базы данных и другие источники информации по химии ------------------------------------ Периодические издания по химии -- Вестник МГУ. ...