... О UNИX . ... Неизменяемая страница . ... Механизмы передачи прав (авторских, имущественных) в рамках государственных проектов. Регламенты публикации результатов проектов . ... Разработка типовых лицензий на приобритаемые в рамках государственных контрактов ФЦП "Электронная Россия (2002-2010 годы) права (авторские, имущественные. ... AltDocs_licenses_research_2004 . ... PspoMaterials/AltDocs_licenses_research_2004 (последним исправлял пользователь eSyr 2009-04-10 01:26:19) . ...
... 34, Database issue doi:10.1093/nar/gkj102 From genomics to chemical genomics: new developments in KEGG 5 Minoru Kanehisa1,2,*, Susumu Goto1, Masahiro Hattori1, Kiyoko F. Aoki-Kinoshita1, Masumi Itoh1, Shuichi Kawashima2, Toshiaki Katayama2, Michihiro Araki2 and Mika Hirakawa1,3 1 2 Bioinformatics Center, Institute for Chemical Research, Kyoto University, Uji, Kyoto 611-0011, Japan, Human Genome Center, Institute of Medical Science, University of Tokyo, ... 34, Database issue D355 Table 1. ...
... Philosophical Transactions of the Royal Society (Biological Sciences) . ... Biochimica et Biophysica Acta (Elsevier Science) . ... Discrete and Continuous Dynamical Systems, Series B (American Institute of Mathematical Sciences) . ... Physics in Medicine and Biology (Institute of Physics) . ... Mathematical Medicine and Biology: A Journal of the IMA . Mathematical Medicine and Biology will publish original articles with a significant mathematical content addressing topics in medicine and biology. ...
... He was graduated from Moscow State University, Faculty of Mechanics and Mathematics, and post-graduate course in a speciality Theory of Probabilities and Mathematical Statistics. ... Ph.D in mathematics in 1980 (Moscow State University, Faculty of Computer Science). ... Author of Popular Textbooks on Data Analysis and Statistics. ... He was graduated from Moscow State University in 1980. Ph.D in mathematics in 1988 (Moscow State University, Faculty of Mechanics and Mathematics). ... InCo . ...
... В Centre for Computing Research and Technology (Франция) будет установлен суперкомпьютер COBALT производства Bull на базе процессоров Intel Xeon E5 с пиковой производительностью около 1.4 PFlop/s . ... Все о мире суперкомпьютеров и параллельных вычислений . ... Самые разнообразные материалы об истории параллельных и высокопроизводительных вычислений, Информация о знаменитых российских и зарубежных суперкомпьютерах прошлого ( БЭСМ-6 , Cray-1 , Эльбрус ), детальная HPC-хронология . ... Центры . ...
... О проекте . ... A prototype of laser unit for Laser Electron X-Ray Generator is constructed on the basis of the optoelectronic control. The laser system in which an optoelectronic negative feedback is realized by means of a signal reflected from an intracavity Pockels cell polarizer is proposed and tested. The design provides flexible control over pulse train time structure. ... Berlin06_Laser.pdf . ...
... Voronin А. Каrmanov D. Savin А. Electronic engineer: . ... Engineer ? ... Electrical design of microprocessor systems, creating software for control and monitoring earth and satellite stations. ... Programming, electrical and layout design of test equipment for testing the silicon matrix for experiment ATIC (Advanced Thin Ionization Calorimeter), creating software for calibration. Electrical design of readout electronics, creating software for collecting and analysis data for experiment NUCLEON . ...
trendence Graduate Barometer Europe 2011 About the survey About trendence trendence Graduate Barometer Europe is an annual online student survey which allows students to express their opinion on topics re lated to career and education. ... Ulrike Heyne Project Manager trendence Graduate Barometer Europe 2011 About the survey Facts and benefits How does it work? ... If your students take part in the trendence Graduate Barometer, they will receive an exclusive Student Report. ...
[
Текст
]
Ссылки http://studsov.math.msu.su/Sites/studsovet/Uploads/trendence_GBE_2011_-_About_the_survey.docs1.pdf -- 209.6 Кб -- 20.10.2012 Похожие документы
... Further tests of the radiocarbon method of age determination (1 3, 6, 8,1 0) for archaeological and geological samples have been completed. All the samples used were wood dated quite accurately by accepted methods. ... TABLE 1 Age Determinations on Samples of Known Age . ... Specific activities for samples of known age. ... The former sample was cypress wood and the latter acacia. ... This committee advised us what samples of known age to use for testing and greatly assisted us in procuring them. ...
1st announcement . INTERNATIONAL SYMPOSIUM ON SPIN WAVES . Saint-Petersburg, May 21 - 24, 2002 . 26th International Symposium on Spin Waves will be held in Saint Petersburg on May 21 -24, 2002 by the Council on Condensed-Matter Physics (Section on Magnetism), Russian Academy of Sciences and A.F. Ioffe Physico-Technical Institute. ... Scope of the Symposium . ... Magnetic excitations in low-dimensional substances . ... Interactions of spin waves with elastic waves and other excitations . ...
... Кафедра системного анализа ВМК МГУ . ... О кафедре . ... на кафедру . ... ВМК . МГУ . ... СМУ ВМК . ... Alexandr Borisovich Kurzhanski) . In Russian . ... Kurzhanski was Elected Associate Member of USSR Academy of Sciences (now changed to Russian Academy of Sciences) in 1981 and Full Member in 1990. He is the Chairman of the Russian National Committee on Automatic Control (the IFAC NMO). ... Chairman of Russian National Committee of Automatic Control. ... 4 (8). pp. 100-118. (in russian). ...
... DEVELOPMENT OF EXPLICIT CYCLIC SCHEMES . WITH CHEBYSHEV?S POLYNOMIALS FOR SPACE NEUTRON KINETICS . ... Questions have been studied to use effectively explicit schemes for solving spatial kinetics. ... Algorithms have been developed to solve spatial kinetic equations on the basis of explicit cyclic schemes with time varying steps designed by V.I. Lebedev [1] as well as schemes of local iterations proposed by O.V. Lokutsievskiy and V.O. Lokutsievskiy [2]. ... Code development. ...
... 1998 1 : Defended the Doctorate Degree Thesis on "Models of Cosmic Ray Particle Fluxes (Development and Applications)". ... Space Weather . ... Nymmik R.A., Radiation Environment Induced by Cosmic Ray Particle Fluxes in International Space Station Orbit According to Recent Solar and Galactic Cosmic Ray Models, Adv. ... Nymmik R.A., Radiation Environment Induced by Cosmic Ray Particle Fluxes in International Space Station Orbit According to Recent Solar and Galactic Cosmic Ray Models, Adv.Space Res. ...
МГУ имени М.В.Ломоносова Русская версия . ... Geography . ... 29 Feb 2016 . ... Head of Department of Economic and Social Geography of Russia, Chair of Commitee of Scientific and Research work, Doctor of Geography. ... Prof. Alexandr Gennadiev - Deputy Head of Department of Landscape Geochemistry and Soil Geography, Doctor of Geography. Prof. Kirill Dyakonov - Head of Department of Physical Geography and Landscape Science, Corresponding Member of Russian Academy of Sciences, Doctor of Geography. ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... Московский государственный университет имени М.В.Ломоносова Меню и виджеты . ... Кафедра иммунологии сегодня . ... В пятницу, 26 февраля 2016 г., в 17-00 в М2 Биофака МГУ состоится четвертая лекция памяти профессора Александра Александровича Ярилина, выдающегося российского иммунолога, профессора и идейного вдохновителя кафедры иммунологии Биологического факультета МГУ им. М.В.Ломоносова. ... Московский государственный университет имени М.В.Ломоносова Биологический факультет Кафедра иммунологии ...
системы автоматизации, автоматизированные системы , информационные системы , мобильные и встраиваемые системы , программное обеспечение, вычислительные системы , средства связи, базы данных, информационные технологии, технологии программирования, обработка изображения, параллельные вычисления, информационное моделирование , математическое моделирование , вычислительный эксперимент, информатика, методы вычислений, численный анализ, ...
... Personal Data 1.1 1.2 1.3 1.4 1.6 1.8 1.9 Name First Name Other Names (//) Date of Birth (d/m/y) Place of Birth Passport (//) Passport issued (d/m/y) / , / / 1.5 1.7 Sex Citizenship M/M /F / 1.10 valid till / / 2. ... Sending Institution 4.1 4.2 4.3 Ti t l e Faculty / Year / Program / Undergraduate Student / Bachelor course / PhD Student / Other: / Master course 5. Language Skills1 5.1 5.2 5.3 5.4 Russian English Other Necessity for Russian Courses at MSU Certificate to be presented 1 , . ...
[
Текст
]
Ссылки http://www.msu.ru/int/stazh/MSU_exchange.pdf -- 86.6 Кб -- 01.02.2012
[
Текст
]
Ссылки http://www.philol.msu.ru/data/foreign/anketa.pdf -- 86.6 Кб -- 29.01.2009
[
Текст
]
Ссылки http://www.ied.msu.ru/files/MSU_exchange_application_2008.pdf -- 86.6 Кб -- 20.11.2008 Похожие документы