... UHECR SINP MSU . ... News . ... TUS Ultra high energy cosmic ray detector on-board the Lomonosov satellite . ... According to existing estimations it can be a prominent source of ultra high energy cosmic rays (UHECR). ... In either case, the newly born magnetar is an attractive site for producing ultrahigh-energy cosmic rays (particles with individual energies exceeding 10 18 e V ; UHECRs). ... A new mechanism for the acceleration of ultra high energy cosmic rays (UHECR) is presented here. ...

Еще в разделе: (Показать все результаты (>11) - uhecr.sinp.msu.ru/ )

• Новости КЛПВЭ

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>5) - mouse.genebee.msu.ru/ )

... Voronov, Vasiliy. Scalability and efficiency of parallel power grid simulations on massively-parallel platforms (submitted). ... 2009. ... Voronov, Vasiliy and Popova, Nina. ... Conference proceedings 2010. ... Abstract Book of SIAM Conference on Parallel Processing for Scientific Computing (SIAM PP10). ... Proceedings of the International Conference on Parallel Computing (ParCo-2009). ... IEEE Computer Press. ... Pozdneev, Alexander and Popova, Nina and Voronov, Vasiliy. ...

Еще в разделе: (Показать все результаты (>3) - angel.cmc.msu.ru/ )

... Фуллерены . ... Химия фуллеренов и их производных . Синтез органических производных фуллеренов . ... синтез органических производных фуллеренов[60] и галогенофуллеренов[60], структурные исследования, модификация синтезированными производными фуллерена наноструктурированной поверхности биосовместимых полимеров, биологические испытания . ... 6) Методы нанесения производных фуллерена на поверхность полимеров . ... Copyright 2006-2012, Лаборатория термохимии, Московский государственный университет . ...

Еще в разделе: (Показать все результаты (>11) - thermolab.chem.msu.ru/ )

Available on CMS information server CMS NOTE 2000/065 The Compact Muon Solenoid Experiment Mailing address: CMS CERN, CH­1211 GENEVA 23, Switzerland CMS Note ``SingleTop'' ­ an event generator for the single top quark production at the LHC. ... But this process has sufficiently different signature which is similar to the top quark pair production signature. ... The events for the two main processes of the single top quark production at the LHC are available in the CMS processes data base PEVLIB [14]. ...

Еще в разделе: (Показать все результаты (>9) - top.sinp.msu.ru/ )

• http://top.sinp.msu.ru/lev/d0note_3612.ps
• Lev V. Dudko Additional Publications

... Monitoring of relativistic electron fluxes in the near-Earth space. Development of the methods for studying of relativistic electrons of fluxes in the regions of precipitation. Studies of the fluxes and spectra of high-energy electrons of the outer radiation belt of the Earth. ... Studies of the fluxes and spectra of high-energy electrons in the low-latitudinal regions (at small L). ... Studies of VLF electromagnetic radiation generated during the main phase of the lightning discharge. ...

Еще в разделе: (Показать все результаты (>3) - vernov-relec.sinp.msu.ru/ )

Московский государственный университет имени М.В. Ломоносова . ... Поступление иностранных граждан . ... Студенческая жизнь . ... Научная жизнь на факультете . Научный отдел . Календарь научных конференций . Научные конференции ФИЯРа . ... Фатющенковские чтения Конференция состоится 17-19 октября 2014 года на факультете иностранных языков и регионоведения МГУ имени М.В. Ломоносова . ... телефон: (495) 734-00-70; факс: (495) 932-88-67 . ... Creative Individual in the Cultural Context: . ...

Еще в разделе: (Показать все результаты (>32) - ffl.msu.ru/ )

• Наш факультет
• About Us

January 2012 EPL, 97 (2012) 26003 doi: 10.1209/0295-5075/97/26003 www.epljournal.org Elastic instability and contact angles on hydrophobic surfaces with p erio dic textures A. L. Dubov 1 1, 2 , J. Teisseire1 and E. Barthel 1 Surface du Verre et Interfaces, UMR 125 CNRS/Saint-Gobain - 39, quai Lucien Lefranc, F-93303 Aubervil liers, Cedex, France, EU 2 A.N. Frumkin ... Finally for an advancing triple line the work of adhesion is (1 + cos adv 1 ~ (l/d)2 =k . ...

Еще в разделе: (Показать все результаты (>28) - nanofluidics.phys.msu.ru/ )

• http://nanofluidics.phys.msu.ru/theses/vardanyan.pdf
• http://nanofluidics.phys.msu.ru/paper/jcp2008.pdf
• http://nanofluidics.phys.msu.ru/paper/pre2012_1.pdf

... Scientific goals . ... Automatic gaze stabilization corrector . Scientific equipment . ... IMISS-1 . ... Comparing the measured and calculated values we?ll find out if it is possible to use microelectromechanical inertial measuring modules in an automatic gaze stabilization corrector , and calculate the value of changes of microsensors? instrumental errors under the space conditions as against the Earth ones. ...

Еще в разделе: (Показать все результаты (>12) - lomonosov.sinp.msu.ru/ )

• Mikhail Lomonosov ? the Pioneer of Russian Science | Университетский спутник

... Ярмарка вакансий и стажировок для студентов и выпускников вузов . ... University of Groningen, The Netherlands . PhD Position available . ... PhD Position in Theoretical Chemistry . ... She is considered to be one of top 5 universities in Europe for research in Materials Science, Chemistry, Space Science, Microbiology, and Environment/Ecology. ... In 1993, the MSCplus was accredited by the Royal Netherlands Academy of Arts and Sciences (KNAW) as a leading Research School in Materials Science. ...

Еще в разделе: (Показать все результаты (>11) - www.physcareer.ru/ )

• Специалист по внедрению систем управления предприятием SAP / Вакансии /
• Radio Frequency Licensing Coordinator (Graduate) / Вакансии / Physcareer.ru