Home . Database of structures of nucleic acid - protein complexes . ... List of complexes . Pfam families . SCOP families . Interaction classes . ... NPIDB . ... Information on SCOP and Pfam domains detected in protein chains is presented. ... Each family has its own web page with the list of entries that include domains of the family. ... List of SCOP domains occurred in DNA-protein and RNA-protein complexes is organized in tree-like form, according to the SCOP classification. ...

Еще в разделе: (Показать все результаты (>88) - npidb.belozersky.msu.ru/ )

... The colleges had gathered a lot of experience in upbringing of young people. ... Keywords: historical anthropology, cultural history, daily city life, women's education, modernisation, school medicine, empress Maria's establishments, closed girls' colleges Strokina A.N., Butareva I.I. Ergonomics measurements of body schoolchildren (p. 30) The article presents the children's body size, intended for the construction of facilities and activities for communities associated with their use of spaces. ...

Еще в разделе: (Показать все результаты (>26) - www.anthropos.msu.ru/ )

• http://www.antropos.msu.ru/vestnic/e2013_1.doc
• http://www.antropos.msu.ru/vestnic/e2013_4.doc
• http://www.antropos.msu.ru/vestnic/e2014_2.doc

LUT Summer School: www.lut.fi/summerschool summerschool@lut.fi Guide for Student Advisers Greetings from your colleagues at Lappeenranta University of Technology! ... With the wide-ranging selection of courses on-offer during the LUT Summer School we aim to both challenge and inspire students. ... Lappeenranta and LUT Lappeenranta is located some 220 km northeast of Finland's capital, and about 230 km northwest of St. Petersburg, Russia. ... The fee will be given on the LUT Summer School web pages. ...

Еще в разделе: (Показать все результаты (>3) - www.phys.msu.ru/ )

... The students of the Faculty of Geography study territorial distribution and spatial development patterns of various natural phenomena as well as social and economic objects. ... The academic program includes courses with lectures, seminars, laboratory and field training in natural sciences and humanities which form 4 blocks: . ... In addition to the field stations of the Faculty, the students have an opportunity to have their field training in scientific institutions and different companies. ...

Еще в разделе: (Показать все результаты (>3) - www.eng.geogr.msu.ru/ )

Neutron diffraction researches of nuclear and magnetic structure of new materials and its correlations with physical properties . Duration of training : 1 year . Supervisor of studies : A.M.Balagurov (professor, D.Sc., bala@nf.jinr.ru ) . ... In FLNP JINR there are unique opportunities for neutronography researches of nuclear and magnetic structure of crystals. ... Supervisor of studies: V.Yu.Pomjakushin (Ph. ... The near order and magnetic structure in amorphous magnetics. ...

Еще в разделе: (Показать все результаты (>25) - foroff.phys.msu.ru/ )

• Postdoctoral training (General Physics and Wave Processes)
• Глубокоуважаемые коллеги
• Postdoctoral training of foreign scientists at Physical Department

Space Weather . ... Space weather . ... Data . ... You should fill in "Workspace" by groups of data sets to create plots. ... Putting different kind of data into the same plot remember, that the first dropped data set chooses and determines the axis scale for all data. ... If you need both kind of scale in the same plot, create two different plots and unite them. The speed of this service depends on 3 components: data processing on server, data transmission and data plotting in your browser. ...

Еще в разделе: (Показать все результаты (>1230) - swx.sinp.msu.ru/ )

• SWX - Космическая погода

... Scaliger sometimes forgot as anyone will when doing chronological computations whether he sought a current or a completed year, and therefore gave Julian dates that did not actually match the cyclical dates his computations had determined (e.g. eras 37,42, and 49). ... This table lists all the eras explicitly given as such by Scaliger, with their positions in the Julian Period and their dates in years BC or AD. ... To find a year in this era, subtract 296 from the date in the era of the Hegira. ...

Еще в разделе: (Показать все результаты (>88) - hbar.phys.msu.ru/ )

... More Reports . ... Variety of long-eared owls (Asio otus) diet, as index of habitat usefulness // Mobility of students and programmes flexibility in the prospect of the European unification of the training processes in ecology and environmental science. ... Long-eared owl A.otus rather actively masters anthropogenous landscapes. In this connection it is interesting to observe change of various aspects of ecology of this species, in particular, dynamics of its food objects. ...

Еще в разделе: (Показать все результаты (>34) - vertebrata.bio.msu.ru/ )

• Выступления студентов и аспирантов на конференциях

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>6) - mouse.genebee.msu.ru/ )

... One of the project objectives was to investigate practical efficiency of some modern iterative methods, including multigrid techniques and domain decomposition methods as well as methods for small compressible materials. ... Hence, the project research initiated because of INTAS financial support contributes in setting up modern computational techniques in tire design. ... Research on efficiency of iterative methods was conducted at the department of Mechanics of Composites about ten years ago. ...

Еще в разделе: (Показать все результаты (>3) - composite.msu.ru/ )

Preconcentration Laboratory . Laboratory of Chromatography . ... Laboratory of Kinetics Methods of Anaysis . ... Sorption-spectroscopy methods for determination of organic . ... Room-temperature ionic liquds, computational chemistry . ... New detection methods in ion and ion-pair chromatography . ... For that purpose, methods of selective preconcentration are developed along with the methods of determination of analytes directly in the sensing film or in the permeate after membrane diffusion. ...

Еще в разделе: (Показать все результаты (>24) - analyt.chem.msu.ru/ )

... Студенческая Астрономическая обсерватория ГАИШ . ... Структура ГАИШ : Отдел внегалактической астрономии : . ... For those really interested in galaxies, extragalactic astronomy or the aspects of cosmology we study, we can always find an interesting problem to work on. ... To make your work in the Group most effective, it would be useful to study the following courses read by our group members as well as the members of other groups in our and other institures. ... Student information . ...

Еще в разделе: (Показать все результаты (>29) - www.sai.msu.ru/ )

• The Catalogue of Interacting Galaxies by Vorontsov-Velyaminov

... General astronomy . ... PHYSICAL CONSTANTS.. ... Nobel Laureates in Physics 1901-2002 . ... Lectures Astronomy-161 "Solar System" (Also it contains info about History of Astronomy) . ... The History of Science . ... College-Level Astronomy Courses - at American, Australian Universities and Colleges . ... Messier: . ... Science . ... Scientific American . ... JOURNAL OF COMPUTATIONAL PHYSICS . ... Scientific Journals . ... American Physical Society Journals: Physical Review, Review of Modern Physics ...

Еще в разделе: (Показать все результаты (>10) - astrometric.sai.msu.ru/ )

• Symbolic circuit processor
• Symbolic matrix processor
• Astronomy

J. K-Theory (page 1 of 10) doi:xxxxxxxxxxxxxxxxxxxxxxxxxxxxx 1 ©2008 ISOPP In memory of Yurii Petrovich Solovyev 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 Yurii Petrovich Solovyev was born on 8 October 1944 in Krasnoyarsk, a city in south central Siberia, on the Yenisei river. ... Hermitian K ­theory played a role in the thesis and became the focus of Solovyev's work in the decade following his thesis. ... Univ. ... 4, 26­35; English transl., ...

Еще в разделе: (Показать все результаты (>284) - higeom.math.msu.su/ )

• http://higeom.math.msu.su/people/garber/talks/2010Texas.pdf
• http://higeom.math.msu.su/people/taras/mypapers/skyebirk.pdf
• http://higeom.math.msu.su/people/taras/TTC/slides/ray.pdf

... Инструкция по работе с информационными ресурсами в ОРОКС . ... Основные разделы сервера: Выбор раздела сервера ------------------------------------ На первую страницу "ChemNet" ------------------------------------ Химический факультет МГУ ------------------------------------ Электронная библиотека по химии ------------------------------------ Базы данных и другие источники информации по химии ------------------------------------ Периодические издания по химии -- Вестник МГУ. ...

Еще в разделе: (Показать все результаты (>4) - do.chem.msu.ru/ )

• Дистанционное обучение на химическом факультете МГУ им. М.В. Ломоносова

SUPERVISOR program User Guide SV version 0.24 Kornilov V., Shatsky N., Voziakova O. March 22, 2004 1 Contents 1 Basic principles 2 Comp onent programs 3 Writing the scenaria 4 Editing the SV configuration file 5 Starting the system A Command list for the communication of the system Sup ervisor A.1 Commands acknowledgment . ... Initialization should b e done b efore scenario starts execution of measurements ­ i.e. b efore sending any commands implying the non-parked status of comp onents. ...

Еще в разделе: (Показать все результаты (>22) - curl.sai.msu.ru/ )

• http://curl.sai.msu.ru/mass/download/doc/dimm_soft_description.pdf
• http://curl.sai.msu.ru/mass/download/doc/infrasoft_eng.pdf
• http://curl.sai.msu.ru/mass/download/doc/massug.pdf

. General Information . Media Files . Participants . Timetable . Local Information . Photos . Back to the album list . Previous . Next Click the image to view it in fullsize. Previous . Next . ASM in twillight. Bright object above the tower is Venus, Mercury is just above the horizon and Saturn between them.

Еще в разделе: (Показать все результаты (>15) - site2010.sai.msu.ru/ )

• General information

Lomonosov Moscow State University FACULTY OF ARTS 2011 ALEXANDER LOBODANOV DEAN OF THE FACULTY OF ARTS WxtЊ vҐЂЂxtzтxс4 g{x YtvтЂрч Ґy TЊрс уxЊx tvvx¶рxw |° ... Since 2003 he has been chairman of the Department of Semiotics and the General Theory of History, founded by him, the first of its kind in Europe. ... Department of Semiotics and the General Theory of Arts The Department of Semiotics and the General Theory of Arts is a theoretical department. ... Galina Zadneprovskaya manages this department. ...

239. http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/rfc2396.txt

240. http://lvk.cs.msu.su/~bahmurov/course_advanced_networks/ITU_OTN_Tutorial.pdf