... Data . ... Solar energetic particles . ... Particle spectra at LEO . ... Average altitude A avg = 832.22 (827-836) km; . Mean altitude anomaly: 815-850 km; . ... Local time on equator on the ascending part of the orbit LT = 8.93 hours; . ... Latitude [deg] . ... Local time [hours] . Magnetic local time [hours] . ... Atmospheric UV and IR flashes and relativistic electron flux oscillogramms near local UV luminosity maxima Iframe support required The data is normalized by local maximum values. ...
... The students of the Faculty of Geography study territorial distribution and spatial development patterns of various natural phenomena as well as social and economic objects. ... The academic program includes courses with lectures, seminars, laboratory and field training in natural sciences and humanities which form 4 blocks: . ... In addition to the field stations of the Faculty, the students have an opportunity to have their field training in scientific institutions and different companies. ...
In the last (1995/96) year, as in the past years, there was few- level astronomical olympiad in Russia. ... We try to use the Olympiads not only to reveal the most bright teenagers and to support the interest to astronomy among schoolchild- ren. ... The main problem which we meet every year is to find financial support to organize the Olympiads. ... To Russian Olympiad on Astronomy and Cosmic Physics (in Russian CyrWin) . Back to Russian Olympiads on Astronomy and Cosmic Physics Home Page . ...
Space Weather . ... Models . Data . ... Space Weather Analysis Centre of SINP MSU provides information about the current state of near-Earth's space. Information Services ( SWX ) on the website of the center provide access to current data describing the level of solar activity, geomagnetic and radiation state of the magnetosphere and the heliosphere in the real time. For data analysis, the models of the space environment, working in off-line as well as on-line mode have been implemented. ...
... defmacro defprinter ( name args &body body ) . ... body ) ) . ... defprinter :property ( type name &rest body ) . print-statement-with-body stream body nil "public ~a ~a" type name ) ) . ... defprinter :get ( &rest body ) . print-statement-with-body stream body nil "get" ) ) . ... defprinter :constructor ( name args &rest body ) . ... defprinter :class ( name &rest body ) . print-statement-with-body stream body t "public class ~a" name ) ) . ... defprinter :namespace ( name &rest body ) . ...
... These CDD-NDs are produced by specific acid treatment of detonation soot, forming tiny rounded sp2 carbon species (carbon dots), 12 atomic layers thick and 12 nm in size, covalently attached to the surface of the detonation diamond nanoparticles. ... In this paper, we report that specific acid treatment of NDcontaining detonation soot, produces tiny rounded sp2 carbon species (carbon dots), which are 12 atomic layers thick and covalently attached to the surface of DND particles. ... Figure 4. ...
[
Текст
]
Ссылки http://rswater.phys.msu.ru/en/articles/2014/Carbon%20dots%20ND%20ppsc201300251.pdf -- 2507.5 Кб -- 02.04.2014 Похожие документы
The Shigeyoshi Matsumae Stadium in Moscow University was opened on September 1, 1989, on the campus of Moscow University, as the first full-scale stadium having artificial turf in the Soviet Union (at that time). ... The stadium was a gift by Tokai University to Moscow University, as the result of more than 20 years of exchange and friendship between Tokai University and Moscow University in exchanging students and teachers, as well as academic and cultural works since 1973. ...
... About Us . ... Symbols of the Faculty . ... Students . ... The English Language Department for Science Faculties . ... The English Language Department for Science Faculties has been part of the Faculty of Foreign Languages and Area Studies since I988 when the latter was established. ... However, professional interests of many members of the Department extend far beyond teaching English to science students the teachers also support other projects of the Faculty of Foreign Languages and Area Studies. ...
... Commission on Paleopedology . ... THE FIRST SCIENTIFIC DESCRIPTION OF EUROPEAN LOESS-PALEOSOL SEQUENCES - Alexander Makeev 08/3/2006 ( 0) . ... paleosol] Re: PalaeoPedology as a Commission - Dr.Stephen Nortcliff 27/11/2003 ( 0) . paleosol] Re: PalaeoPedology as a Commission - dan yaalon 26/11/2003 ( 0) . paleosol] Re: The future of the Paleopedogy Commission - Mermut 28/9/2003 ( 0) . ... Definition of paleosol and geosol; memo to John Catt - Roger Morrison 10/10/99 ( 1) . ...
... Юрий (admin) Новости Mayer Salovey-Caruso Emotional Intelligence Test , MSCEIT , видео , лекции , эмоциональный интеллект No Comments . О том, как эмоции активируют интеллектуальные процессы и оказывают избирательное влияние на их содержание можно узнать из сегодняшней лекции профессора кафедры психологии Йельского университета Дэвида Карузо . ... Mayer Salovey-Caruso Emotional Intelligence Test. ... ЖЖ-сообщество ?RU_SPSS? ... Скачать SPSS . Статистика блога . ...
... О Центре . ... Открытие Центра . ... Технологии Intel . Технологии программирования . ... Технологии Intel в основе учебного процесса . ... подробной технической информации о разработке игр, мультимедийных приложений, решений для совместной работы и финансового ПО; . ... Страница Центра компетенции (ЦК) СО РАН-Intel по высокопроизводительным вычислениям. Репортаж об официальном открытии Центра . ... Зарегистрируйтесь на сайте поддержки продуктов . ... на сайт поддержки. ...
... A p P EC Astropar ticle Physics for Europe · Cosmic rays: A large array for the detection of charged cosmic rays ( Auger North) · Gamma rays: A large array of Cherenkov Telescopes for detection of cosmic high energy gamma-rays ( CTA ) · High energy neutrinos: A cubic kilometre-scale neutrino telescope in the Mediterranean (KM3NeT) · Dark matter search: Ton-scale detectors ... A p P EC Astropar ticle Physics for Europe · Cosmic rays: AMS detector launched. ...
trendence Graduate Barometer Europe 2011 About the survey About trendence trendence Graduate Barometer Europe is an annual online student survey which allows students to express their opinion on topics re lated to career and education. ... Ulrike Heyne Project Manager trendence Graduate Barometer Europe 2011 About the survey Facts and benefits How does it work? ... If your students take part in the trendence Graduate Barometer, they will receive an exclusive Student Report. ...
[
Текст
]
Ссылки http://studsov.math.msu.su/Sites/studsovet/Uploads/trendence_GBE_2011_-_About_the_survey.docs1.pdf -- 209.6 Кб -- 20.10.2012 Похожие документы
... The luminescence time dependence for two types of core/shell QDs (CdSe/CdS and CdTe/CdSe ) were investigated and were compared with behavior of naked ones (CdSe). ... Three different types of QDs were used in this work: simple core CdSe QDs, core/shell CdSe/CdS QDs and type II core/shell CdTe/CdSe heterostructures in charge carrier division regime (Fig.1). ... So core/shell nanocrystals demonstrate intermediate behavior between CdSe core-type QDs and CdTe/CdSe core/shell heterostructures. ...
... Siberian Lang . Minority languages of Siberia as our cultural heritage . ... The project ?Development of the web-site ?Minority languages of Siberia as our cultural heritage? (on the material of the languages of the basin Middle Yenisei and the Middle and the Upper Taz)? was realized at the Laboratory for Computational Lexicography, Research Computing Centre, Lomonosov Moscow State University, with financial support from Russian Foundation for the Humanities, grant 12-04-12049.љ ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
Search: . Word Search . ... All alternatives . Papers: . EDAS (submitted) . Other Papers . ... Department of Bioengineering and Bioinformatics, Moscow State University. State Scientific Center GosNIIGenetika. ... To navigate this site please install the latest version of Macromedia Flash Player for Windows or for Linux . If you do not wish to install Flash you could use text pages with less functionality. ...
... Учителям . ... 2015 . ... Осень 2015 года . ... Открыта запись на Летнююљшколуљдля учителей физики 2016љгода . Опубликована программа и открыта запись на Университетскиељсубботы в МГУ имени М.В.Ломоносова весеннего семестраљ2016 года .љ Факультет иностранных языков и регионоведения объявляет наборључащихся 11 классов на интенсивные подготовительные курсы љ(апрель-май 2016 г.), а также приглашает преподавателей и учителей иностранных языков на дистанционные курсы повышения квалификации ? ...
DAYS on DIFFRACTION' 2011 77 Analytical solutions for diffraction problem of nonlinear acoustic wave b eam in the stratified atmosphere Vladimir A. Gusev, Ruslan A. Zhostkow Department of Acoustics, Physical Faculty, Lomonosov's Moscow State University, Russia; e-mail: vgusev@bk.ru The nonlinear wave equation and mo dified KhokhlovZab olotskaya typ e equation for high intensive acoustics wave b eams propagating in stratified atmosphere with inhomogeneous of sound sp eed is set up. ...
[
Текст
]
Ссылки http://acoustics.phys.msu.su/teachers/gusev_files/diff2011.pdf -- 68.4 Кб -- 07.11.2012
[
Текст
]
Ссылки http://acoustics.phys.msu.ru/teachers/gusev_files/diff2011.pdf -- 68.4 Кб -- 07.11.2012 Похожие документы