... Kirk Hatfield . ... J. Hydrol. In Review). Klammler H., K. Hatfield, and M. Annable. ... Newman, M., K. Hatfield, J. Hayworth, P.S.C. Rao, and T. Stauffer. ... Hatfield, K., M. Annable, J. Cho, P.S.C. Rao, and H. Klammler. ... Brooks, M., M. Annable, P.S.C. Rao, K. Hatfield, J. Jawitz, W. Wise, A. Wood, C. Endfield. ... Brooks, M.C., M.D. Annable, P.S.C. Rao, K. Hatfield, J.W. Jawitz, W.R. Wise, A.L. Wood, and C.G. Enfield. ... Hatfield, K., M.D. Annable, S. Kuhn, P.S.C. Rao, and T. Campbell. ...

Еще в разделе: (Показать все результаты (>138) - mgumus.chem.msu.ru/ )

• MGUMUS -- Researches

Neutron diffraction researches of nuclear and magnetic structure of new materials and its correlations with physical properties . Duration of training : 1 year . Supervisor of studies : A.M.Balagurov (professor, D.Sc., bala@nf.jinr.ru ) . ... In FLNP JINR there are unique opportunities for neutronography researches of nuclear and magnetic structure of crystals. ... Supervisor of studies: V.Yu.Pomjakushin (Ph. ... The near order and magnetic structure in amorphous magnetics. ...

Еще в разделе: (Показать все результаты (>24) - foroff.phys.msu.ru/ )

• A GLIMPSE BACK INTO THE HISTORY

Space Weather . ... Space weather . ... Data . ... You should fill in "Workspace" by groups of data sets to create plots. ... Putting different kind of data into the same plot remember, that the first dropped data set chooses and determines the axis scale for all data. ... If you need both kind of scale in the same plot, create two different plots and unite them. The speed of this service depends on 3 components: data processing on server, data transmission and data plotting in your browser. ...

Еще в разделе: (Показать все результаты (>4) - swx.sinp.msu.ru/ )

ISSUE 1 RUSSIA U.S. BILATERAL ON CYBERSECURITY CRITICAL TERMINOLOGY FOUNDATIONS APRIL 2011 The Russia U.S. Bilateral on Cybersecurity ­ Critical Terminology Foundations Issue 1 The principle editors of this document are: Karl Frederick Rauscher, EastWest Institute and Valery Yaschenko, Information Security Institute of Moscow State University. ... INFORMATION AND CYBER .. ... Scientific Adviser to the Director of the Lomonosov Moscow State University Institute of Information Security Issues. ...

Еще в разделе: (Показать все результаты (>11) - iisi.msu.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>9) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

... General astronomy . ... PHYSICAL CONSTANTS.. ... Nobel Laureates in Physics 1901-2002 . ... Lectures Astronomy-161 "Solar System" (Also it contains info about History of Astronomy) . ... The History of Science . ... College-Level Astronomy Courses - at American, Australian Universities and Colleges . ... Messier: . ... Science . ... Scientific American . ... JOURNAL OF COMPUTATIONAL PHYSICS . ... Scientific Journals . ... American Physical Society Journals: Physical Review, Review of Modern Physics ...

Еще в разделе: (Показать все результаты (>18) - astrometric.sai.msu.ru/ )

• AMT articles

NMW survey overview . Access image archive . ... The New Milky Way survey aims to detect bright (V<13.5) optical transients near the Galactic plane using an automated wide-field (8x6 deg.) system capable of surveying the whole Milky Way area visible from the observing site in one night. ... All images obtained during the transient search survey are available online (please use the image archive access form ). ... Images per field: . ... Images per night: . ... Milky Way imaging time: . ...

Еще в разделе: (Показать все результаты (>2) - scan.sai.msu.ru/ )

ВМиК-Online! ... Факультет . ... Абитуриенты . ... Вариант письменного вступительного экзамена . по английскому языку . Отделение бакалавров факультета ВМиК . ... They found that cannabis users are 40 percent less effective in fighting viruses than normal people. ... Группа В Контакте для абитуриентов ВМК МГУ: . Поступление на ВМК МГУ 2012 . Форум абитуриентов ВМК МГУ . ... Телефон приемной комиссии факультета ВМиК МГУ: . ... 2001 2012 ВМиК Online! ...

Еще в разделе: (Показать все результаты (>7) - www.cmc-online.ru/ )

Cell Biology International 27 (2003) 293­294 Cell Biology International www.elsevier.com/locate/jnlabr/ycbir Short communication Microtubule dynamics in living cells : direct analysis in the internal cytoplasm Ivan A. Vorobjev a a,* , Irina B. Alieva a, Ilya S. Grigoriev b, Gary G. Borisy c Laboratory of Cell Motility, A.N. Belozersky Institute, Moscow State University, Moscow, Russia b Department of ... These data demonstrate that MT growth is impeded at the cell margin. ...

Еще в разделе: (Показать все результаты (>38) - cellmotility.genebee.msu.ru/ )

• publications

... MOIP (Moscow Society of Naturalists) is a unique social phenomenon in Russia?s life. ... Great scientists and thinkers such as academicians V.I. Vernadskiy and N.D. Zelinskiy presumed that MOIP acted in Moscow as the Academy of Sciences up to the Saint-Petersburg (Russian) Academy moving to the capital in the thirties of 20 th century. In the course of all these years, the Moscow Society of Naturalists united and coordinates almost all scientific potencies in the sphere of natural science. ...

Еще в разделе: (Показать все результаты (>3) - www.moip.msu.ru/ )

... В данном разделе приводятся публикации проекта по созданию семейства реконфигурируемых вычислительных систем в рамках государственного контракта N 02.524.12.4002 от 20 апреля 2007 г. федеральной целевой программы "Исследования и разработки по приоритетным направлениям развития научно-технологического комплекса России на 2007-2012 годы". ... Материалы Международной научной конференции "Параллельные вычислительные технологии" (ПаВТ 2008), г. Санкт-Петербург, 29 - 31 января 2008, Россия. ... Минск,...

Еще в разделе: (Показать все результаты (>6) - fpga.parallel.ru/ )

... The model was then employed to assess the dependence of the association rate constant on the dimensions of the lumen. ... This small (10.5 kDa) protein diffuses in the lumen, a relatively narrow closed space between the thylakoid membranes, oxidizing cytochrome f (Cyt f ) in the membrane complex and then reducing the PS I reaction center. ... However, these works did not consider the diffusion of Pc molecules in the thylakoid lumen or their interaction with the b6 f and PS I membrane-bound complexes...

Еще в разделе: (Показать все результаты (>19) - www.library.biophys.msu.ru/ )

• http://www.library.biophys.msu.ru/PDF/80524.pdf

... Earlier still lies the remaining frontier, where the first stars, galaxies and massive black holes formed. ... Building on this general framework, and relying on the development of efficient new computational tools, the fragmentation properties of primordial gas inside such minihaloes were investigated with numerical simulations, leading to the result that the first stars, so-called population III, were predominantly very massive4,8 (see Box 1 for the terminology used here). ... Astrophys. ... III. ...

Еще в разделе: (Показать все результаты (>14) - ocean.phys.msu.ru/ )

• http://ocean.phys.msu.ru/courses/geo/lectures-addons/15/2001%20Demorest%2C%20Dynamo%20theory%20and%20Earth's%20magnetic%20field%20.pdf

Lomonosov Moscow State University FACULTY OF ARTS 2011 ALEXANDER LOBODANOV DEAN OF THE FACULTY OF ARTS WxtЊ vҐЂЂxtzтxс4 g{x YtvтЂрч Ґy TЊрс уxЊx tvvx¶рxw |° ... Since 2003 he has been chairman of the Department of Semiotics and the General Theory of History, founded by him, the first of its kind in Europe. ... Department of Semiotics and the General Theory of Arts The Department of Semiotics and the General Theory of Arts is a theoretical department. ... Galina Zadneprovskaya manages this department. ...

235. Инструкции для преподавателей по работе в системе дистанционного обучения

236. http://www.innovation.msu.ru/SEEC-LMSU_Detailed_Program_Itinerary_Oct28-Nov5_2007.doc

237. http://beams.chem.msu.ru/sotrudniki/larin/CC_EF1f.doc

238. Appendix: Scaliger's List of Eras

239. http://www.msm.biophys.msu.ru/archive/doc14869/eng.pdf

240. Europrobe2