Radiation Physics and Chemistry 61 (2001) 241246 Radiation in archaeometry: archaeological dating Marco Martini*, Emanuela Sibilia " INFM and Dipartimento di Scienza dei Materiali, dell' Universita degli Studi di Milano, Bicocca, via R. Cozzi 53, 20133 Milan, Italy Abstract Crystalline inclusions contained in ceramics act as thermoluminescent dosimeters, the irradiation source being the natural radiation environment. ... Keywords: Thermoluminescence; Dosimetry; Ceramics; Archaeological dating 1. ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
Welcome to ASC14 To whom it may concern With the supports from the High Performance Computing (HPC) experts and organizations, the ASC13 Student Supercomputer Challenge has concluded with great success. ... We are calling for registration and preliminary contest preparation. ... Some of them may finally take HPC as a career option, such as some students from National Defense University team have already contributed to the Tianhe-1A and Tianhe2. ... Award Overall Gold Winner: 100K RMB (~16000 USD) . ...
[
Текст
]
Ссылки http://smu.cs.msu.ru/sites/default/files/attachments/ASC14%20Invitation%20Letter.pdf -- 1094.9 Кб -- 04.12.2013
[
Текст
]
Ссылки http://smu.cs.msu.su/sites/default/files/attachments/ASC14%20Invitation%20Letter.pdf -- 1094.9 Кб -- 04.12.2013
[
Текст
]
Ссылки http://smu.cmc.msu.ru/sites/default/files/attachments/ASC14%20Invitation%20Letter.pdf -- 1094.9 Кб -- 04.12.2013 Похожие документы
... In 1895 two courses of Painlevґ lectures were published: e's "Leё cons sur l'intґ egration des ґ equations diffґ tielles de la mґ eren ecanique et applications" [47] and "Leё cons sur le frottement" [48]. ... Sur Sur Sur Sur Sur la reprґ tation conforme esen les ґ equations diffґ tielles eren les ґ equations diffґ tielles eren les ґ equations diffґ tielles eren les ґ equations diffґ tielles eren 1888 des polygones. ... C.R. 122; 13191322). eren Sur les ґ equations diffґ tielles du premier ordre. ...
... Lomonosov Moscow State University . ... Home About The Department of land resources . ... The main tasks of the Department is the development of methods for effective land management aimed at sustainable development and food security, implementing technology for soil protective land using, analysis of the current state of land resources, assessment of land degradation and water quality reduction. ... The Department of land resources is headed by doctor of biological Sciences Pavel Krasilnikov. ...
Open Conference Systems . ... Username . Password . ... Email* . ... Bahamas Bahrain Bangladesh Barbados Belarus Belgium Belize Benin Bermuda Bhutan Bolivia Bosnia and Herzegovina Botswana Bouvet Island Brazil British Indian Ocean Territory Brunei Darussalam Bulgaria Burkina Faso Burundi Cambodia Cameroon Canada Cape Verde Cayman Islands Central African Republic Chad Chile China Christmas Island Cocos (Keeling) Islands Colombia Comoros Congo Congo, The Democratic Republic Of The Cook ...
... Отдел культуры древности . Отдел культуры и науки средневековой Европы . Отдел христианской культуры . Отдел русской культуры . ... Mellon Foundation / University of Chicago Dissertation Year Fellowship. ... Francois Furet Travel Grant (summer travel to France). ... FLAS (Title 6) fellowship for summer study of Turkish. ... DAAD Fellowship for summer study in Germany. ... Humanities and Social Sciences Research Grant Summer 1998. ... Soros Graduate Fellowship (grant #H2B70H), 1 year. ...
... Геология >> Геохимические науки | ... Институт минералогии Уральского отделения РАН и Южно-Уральский госуниверситет (филиал в г. Миассе) проводят научную студенческую школу, посвященную проблемам рудообразования, методам оценки и истории освоения месторождений в островодужных . ... РОССИЙСКАЯ АКАДЕМИЯ НАУК Межведомственный петрографический комитет СИБИРСКОЕ ОТДЕЛЕНИЕ РАН Объединенный институт геологии, геофизики и минералогии имени. ... Конференция "Геохимия урана - 2003" (Uranium Geochemistry 2003)...
The Department of Talented Youth Affairs and Professional Orientation . ... From May 15 to June 15 (2014), the design centre ?Artplay? hosts ?Robot ball? which represents an International Meeting of Modern Robots (official website: balrobotov.ru ). ... In order to participate in the ?Robot Ball?, more than 40 robots arrived in Moscow from USA, France, Germany, UK, South Korea, Japan, Russia, Canada, etc. ... 2016 - The Department of Talented Youth Affairs and Professional Orientation ...
ВМиК-Online! ... Студенты . ... Работа . ... Компания Advanced Chemistry Development, Inc. ACD/Labs) была основана в 1993 году группой аспирантов химфака и ВМиК МГУ и насчитывает на данный момент около 140 человек. ... Всемирная дистрибьюторская сеть ACD/Labs состоит из 13 дистрибьюторов на 5 континентах. ... ACD/Labs приглашает выпускников факультета вычислительной математики и кибернетики МГУ начать свою карьеру в нашей компании в качестве программистов Delphi. ... МГУ . ... ACD/Labs . ...
... О факультете | ... Структура факультета . ... В Мурманске открывается Год российского кино, который продолжит Год литературы . ... 16.02.2016 Год кино начинается на Алтае . Сегодня, 16 февраля, в Барнауле открывается Год российского кино . ... Виталий Третьяков считает, что телевидение должно иметь 'книжный фундамент', то есть опираться на традиционные культурные ценности человечества.. ... 2009-2014 Высшая школа телевидения МГУ им. М.В.Ломоносова . ...
... Moscow State University Russian Language Centre . Moscow State University . ... Learn Russian at the Russian Language Centre! ... US Librarian of Congress James Billington published a book "Russia in Search of Itself" on Russian history and its modern comprehension. (more.. ... The Ministry of Education and sciences of Russia, Embassy of France in Moscow and the Moscow State University after M.V. Lomonosov invite you to take part in the international Russian-French youth competition. (more...) . ...
... CELL BIOPHYSICS Application of a Photosystem II Model for Analysis of Fluorescence Induction Curves in the 100 ns to 10 s Time Domain after Excitation with a Saturating Light Pulse N. E. Belyaevaa, V. Z. Pashchenkoa, G. Rengerb, G. Yu. ... In the case of weak measuring light, the steady-state level of fluorescence induction curve (Fig. ... The model of PSII predicted that, upon long (10 s) exposure to weak measuring light, the states with open RCs are being populated (Fig. 4, curves 3, 5 QA). ......
... Во Франции появилась целая плеяда крупных историков, труды которых обрели широкое международное звучание. ... В послевоенные годы сохранили свое влияние сторонники релятивистской "критической философии истории", которую до войны пропагандировал философ, социолог и политолог Раймон Арон. ... Занимая кафедру экономической и социальной истории в Парижском университете, он подготовил множество учеников, и в немалой мере определил направление исследований целого поколения французских историков. ...
... 20 , 2014, , Outlines · Cosmological impact of new stable particles: direct and indirect searches for dark matter · Cosmological patterns of particle symmetry breaking: archioles, massive PBH clusters, antimatter domains . ... They are: · Inflation · Baryosynthesis · Dark matter/energy All these phenomena imply extension of the Standard Model of Strong (QCD) and Electroweak Interactions. ... Dark Matter from Charged Particles? ... Advances in High Energy Physics, vol. ...
Alexander S. Antonov . ... M.V.Lomonossov Moscow State University . ... June 4, 1999, Moscow State University . ... 1994-2000: programmer, Laboratory of Parallel Information Technologies, Research Computer Center, Moscow State University . ... A.S. Antonov, A.M. Teplov. ... Antonov A.S., Voevodin Vl.V., Sobolev S.I., Filamophitskiy M.P. Internet-Auditorium of Lomonosov Moscow State University // Abstracts of the All-Russian scientific conference "Scientific Services Internet" (Novorossiysk, 2000). ...