Synthesis and Use of Humic Derivatives Covalently Bound to Silica Gel for Np(V) Sequestration I.V. Perminova , L.A. Karpiouk, N.S. Shcherbina*, S.A. Ponomarenko§, St.N. Kalmykov, and K. Hatfield Department of Chemistry, Lomonosov Moscow State University, Moscow 119992, Russia Vernadsky Institute of Geochemistry and Analytical Chemistry, Russian Academy of Sciences, Moscow 119991, Russia § Institute of Synthetic Polymer ... I.V. Perminova, et al. ...

Еще в разделе: (Показать все результаты (>122) - mgumus.chem.msu.ru/ )

• http://www.mgumus.chem.msu.ru/publication/2010/2010-kazachkov-optimization.pdf
• http://www.mgumus.chem.msu.ru/publication/2009/2009-kunenkov-total.pdf
• http://www.mgumus.chem.msu.ru/ihss/pdf/nl_36.pdf

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>6) - mouse.genebee.msu.ru/ )

... Academic Programmes . ... Vestnik CIE (in Russian) . ... Elective Courses . ... The XIX century Russian Literature; . ... Open to all interested students, this course is especially useful for those who are preparing for Certificate examination (upper levels), or engaged in translation and interpreting; for teachers of Russian as a foreign language. The course s ultimate goal is to build a diversified set of skills that will enable students to explore various genres of Russian Media independently. ...

Еще в разделе: (Показать все результаты (>21) - www.cie.ru/ )

• Information about Moscow :: Useful Information :: CIE
• Film about CIE :: About Center for International Education :: CIE

... Новости . ... О кафедре . ... Занятия в среду 7.11.2012 по Современным компьютерным технологиям (преподаватель Краев А.В.) на первой паре не состоится и переносится в связи с календарным отпуском преподавателя. ... Автор: Краев Андрей Владимирович 06.11.2012 . ... Будут заслушены доклады Аристова А.И., Карамышевой Т.В., Краева А.В., Будановой А.В. Автор: Фурсов Андрей Серафимович 27.10.2012 . ... Colin Angle - основателя и руководителя компании iRobot, крупного специалиста в области робототехники. ...

Еще в разделе: (Показать все результаты (>6) - ndsipu.cmc.msu.ru/ )

General Information . ... Symposium expenses . ... Presentation information . ... Travel information . ... 14 European Symposium on . Gas Phase Electron Diffraction . ... From metro station "Belorusskaya" (green line) travel to metro station "Teatral'naya" (green line). ... From metro station "Paveletskaya" (green line) travel to metro station "Teatral'naya" (green line). ... After that make a change to "Biblioteka imeni Lenina" (red line) and travel on to metro station 'Universitet' (red line). ...

Еще в разделе: (Показать все результаты (>2) - ged.chem.msu.ru/ )

... B Dispatch: 30.1.04 Author Received: Journal: JEB CE: Kumar No. of pages: 12 PE: Sri doi:10.1111/j.1420-9101.2004.00705.x Human birthweight evolution across contrasting environments F. T H OMAS , * A . ... The model illustrates that optimal birthweight depends on which fitness-reducing risk locally predominates (somatic diseases, parasitic diseases or adverse environmental conditions). ... Growth in utero, blood pressure in childhood and adult life, and mortality from cardiovascular disease. ...

Еще в разделе: (Показать все результаты (>33) - ecology.genebee.msu.ru/ )

• http://ecology.genebee.msu.ru/3_SOTR/CV_Terekhin_publ/2002_Host_manip_IJP.pdf
• http://ecology.genebee.msu.ru/3_SOTR/CV_Terekhin_publ/2001_RadialMaze.doc
• http://ecology.genebee.msu.ru/3_SOTR/CV_Terekhin_publ/2009_Crazy_Fred.doc

... Variations in soil acidity and in biodiversity were analysed in the National Natural Park "Russian North", European Russia. Improving soil quality from podzol, podzolic soil, derno-podzolic soil, brown earth to pararendzina leads to increase in diversity and changes in floristical composition, followed by changing of pine and spruce forest to mixed and birch forests. ... Our study shows that plants notably respond to soil acidification in boreal forest ecosystems. back . ...

Еще в разделе: (Показать все результаты (>24) - eco.soil.msu.ru/ )

• Acid Deposition and Forest Soils. Eds. V.Nikonov G.Koptsik
• Pollution of Soils and Plants by Nickel and Copper
• Pine Needle Chemistry near a Large Point SO2 Source in Northern Fennoscandia

... The characteristics of the materials we have selected, the procedure of winding the optic fibers and the coating process are described in detail. ... The `passive' inner cylinder, shown in the left part of the picture, was machined from an anticorodal aluminum rod while the conical part is used to lead the optic fibers from the coils down to the axis of the hydrophone. ... 6: The sensor after the coating process: the hydrophone (right) and the box --7-- containing the two fiber Bragg gratings. ...

Еще в разделе: (Показать все результаты (>16) - antares.sinp.msu.ru/ )

• http://antares.sinp.msu.ru/docs/INFN%20-%20Paper%203.pdf

I NSTITUTE OF PHYSICS PUBLISHING PHYSICAL B IOLOGY Phys. Biol. 3 (2006) 121­129 doi:10.1088/1478-3975/3/2/004 Direct simulation of plastocyanin and cytochrome f interactions in solution I B Kovalenko1,AMAbaturova1, P A Gromov2,DMUstinin1, E A Grachev2, G Yu Riznichenko1 and ABRubin1 1 2 ... 2006 Online at stacks.iop.org/PhysBio/3/121 Abstract Most biological functions, including photosynthetic activity, are mediated by protein interactions ... We use this structure in our simulation. ...

Еще в разделе: (Показать все результаты (>39) - library.biophys.msu.ru/ )

• http://library.biophys.msu.ru/PDF/3336.pdf
• http://library.biophys.msu.ru/PDF/3329.pdf
• http://library.biophys.msu.ru/matorin/3385.pdf

ISSN 1560-3547, Regular and Chaotic Dynamics, 2015, Vol. ... The Dynamics and Control of a Spherical Robot with an Internal Omniwheel Platform Yury L. Karavaev1* and Alexander A. Kilin 1 2** M. T. Kalashnikov Izhevsk State Technical University, ul. ... The problem of control of spherical robot motion along an arbitrary tra jectory is solved within the framework of a kinematic mo del and a dynamic mo del. ... To describe the motion of a spherical robot, we consider three coordinate systems. ... Vol. ...

Еще в разделе: (Показать все результаты (>106) - ics.org.ru/ )

• http://ics.org.ru/upload/iblock/76b/2524.pdf
• http://ics.org.ru/upload/iblock/704/186-the-self-propulsion-of-a-body-with-moving-internal-masses-in-a-viscous-fluid_ru.pdf
• http://ics.org.ru/upload/iblock/4bf/191-the-bifurcation-analysis-and-the-conley-index-in-mechanics_ru.pdf

Revised: 21 May 2014, Accepted: 27 May 2014, Published online in Wiley Online Library (wileyonlinelibrary.com) DOI: 10.1002/jmr.2399 Force -induced globule-coil transition in laminin binding protein and its role for viral- cell membrane fusion Boris N. Zaitseva, Fabrizio Benedettib,e, Andrey G. Mikhaylovb, Denis V. Korneeva, Sergey K. Sekatskiib*, Tanya Karakouzb, Pavel ... 2008, 2010). ... This should permit us to elucidate still unclear aspects of viral-cell membrane interaction and fusion. ...

Еще в разделе: (Показать все результаты (>5) - cell.biophys.msu.ru/ )

• RecentChanges

... Online Services | ... Electronic Chart of Deformation gives to one possibility to obtain in comfortable form (analogous to that of well-known Charts of the Nuclides) numerical information for various nuclear deformation parameters (quadrupole moment Q and quadrupole deformation parameter b 2 ) for ground states of many nuclei and contains the data from three sources: . ... This table is a result of a combined analysis of two types of experimental data on nuclear charge radii. ... A799 (2008) 30 . ...

Еще в разделе: (Показать все результаты (>41) - cdfe.sinp.msu.ru/ )

• CDFE - Centre for Photonuclear Experiments Data - Home page
• Index of /services/wftables

THE RUSSIAN STYLE OF CIVIL PROCEDURE Dmitry Maleshin Reprinted from Emory International Law Review Volume 21, No. ... 26 See id. ... Another exceptional feature of the Russian civil procedure is the original status of judicial precedent as a source of Russian civil procedural law. ... 98 See OSCAR G. CHASE, LAW , CULTURE, AND RITUAL: DISPUTING SYSTEMS IN CROSS-CULTURAL CONTEXT 53-55 (2005); JAMES ET AL., supra note 6, at 309-10; THOMAS MAIN, GLOBAL ISSUES IN CIVIL PROCEDURE 5 (2006); Oscar G. Chase. ...

Еще в разделе: (Показать все результаты (>5) - www.law.msu.ru/ )

This section of library contains information about "classic" Star Catalogs. ... For a Henry Draper Catalog 272149 stars have received a total of 531,211 identifications in 7 сatalogs: . 270456 - in Astrographic Catalogue ( "Carte du Ciel", 4M), . 251943 - in Guide Stars Catalog (GSC), . ... A file with information on the components of 1788 of multiple systems in catalog HDEC (3681 component, or a combination thereof, with 4054 recording). ... A file with information about 21971 variable stars. ...

Еще в разделе: (Показать все результаты (>16) - astrometric.sai.msu.ru/ )

• Symbolic circuit processor
• Symbolic matrix processor

... UHECR SINP MSU . ... News . ... TUS Ultra high energy cosmic ray detector on-board the Lomonosov satellite . ... According to existing estimations it can be a prominent source of ultra high energy cosmic rays (UHECR). ... In either case, the newly born magnetar is an attractive site for producing ultrahigh-energy cosmic rays (particles with individual energies exceeding 10 18 e V ; UHECRs). ... A new mechanism for the acceleration of ultra high energy cosmic rays (UHECR) is presented here. ...

Еще в разделе: (Показать все результаты (>8) - uhecr.sinp.msu.ru/ )

• Новости КЛПВЭ

Russian TeX Disk . ... Please, use "Save link as" (right mouse button) for downloading files, otherwise binary files will be corrupted. What is russian TeX disk . ... Some TeX versions and tools are installed/russified and can be started directly from CD; other are only distributives plus additional files for their russification. ... FPTEX . ... Directory russian.add: Generic files (mf-sources, pfb-fonts and hyphen file) for russification of any-TeX-realizations in: . ... file readme: . ...

Еще в разделе: (Показать все результаты (>5) - tex.bog.msu.ru/ )

• http://tex.bog.msu.ru/emtex.html
• http://tex.bog.msu.ru/rustexeo.html

... Инструкция по работе с информационными ресурсами в ОРОКС . ... Основные разделы сервера: Выбор раздела сервера ------------------------------------ На первую страницу "ChemNet" ------------------------------------ Химический факультет МГУ ------------------------------------ Электронная библиотека по химии ------------------------------------ Базы данных и другие источники информации по химии ------------------------------------ Периодические издания по химии -- Вестник МГУ. ...

Еще в разделе: (Показать все результаты (>3) - do.chem.msu.ru/ )

... In this article, the light propagation in a diffuser with optically soft inclusions is described with the help of the Fokker­Planck equation, i.e., a transfer equation with a diffusion term in the space of radiation-propagation directions. The coefficient of angle diffusion is calculated using the Mie theory. The equation is solved numerically using the stochastic analog method, and the space and angle distribution of the radiation that passed through the diffuser is calculated. ...

Еще в разделе: (Показать все результаты (>15) - lizard.phys.msu.su/ )

• http://lizard.phys.msu.su/home/science/sust-2003-17-443.pdf
• http://lizard.phys.msu.su/home/science/Dmitriev-Zvyagin-10-Uspekhi-final.pdf
• http://lizard.phys.msu.su/home/science/physE-2001.pdf

EMBEDDING FORMULAE FOR DIFFRACTION BY NON-PARALLEL SLITS by E. A. Skelton1 , R. V. Craster1 A. V. Shanin2 ( 1 Department of Mathematics, Imperial ... (Acoustics Division), Moscow State University, 119992, Leninskie Gory, Moscow, Russia ) [Received Octob er 24, 2007] Summary Emb edding formulae for diffraction theory encode the diffraction coefficients for some given wave incidence on a scatterer in terms of the ... The directivity of these edge Green's ^ functions are denoted by Dj (; al± ). ...

Еще в разделе: (Показать все результаты (>38) - acoustics.phys.msu.ru/ )

• http://acoustics.phys.msu.su/teachers/rudenko_files/98sweisarv.pdf
• http://acoustics.phys.msu.su/teachers/gusev_files/diff2011.pdf
• http://acoustics.phys.msu.su/teachers/shanin_files/~shanin/papers/polosa3.pdf

... Bohm limit DB=vrg/3: Emax Emax ush 0.3 Ze B Rsh c 1014(B/Bism) Z eV B Hillas criterion ! ... Voelk 2000; Kang Jones 2006) - Bohm diffusion in amplified magnetic field B2/8 = 0.035 u2/2 ( Voelk et al. 2005 empirical; Bell 2004 , Zirakashvili VP 2008 theoretical) - account for Alfvenic drift w = u + Va upstream and downstream - relative SNR rates: SN Ia : IIP : Ib/c : IIb = 0.32 : 0.44 : 0.22 : 0.02 Chevalier 2004 , Leaman 2008, Smart et al 2004, Berezinsky et al 2006 Das et al. ...

Еще в разделе: (Показать все результаты (>6) - tunka.sinp.msu.ru/ )

• http://tunka.sinp.msu.ru/en/presentation/horns_vhe.pdf