Научная Библиотека . Отдел Обслуживания Физического Факультета МГУ . ... Электронные ресурсы . ... Ресурсы МГУ . ... Сайт Библиотеки МГУ . ... Напоминаем Вам, что каждый, кто пользуется доступом к журналам в электронном виде, как из помещений библиотеки, так и со всех компьютеров физического факультета не может прямо или косвенно использовать просматриваемые и сохраняемые материалы для: . ... Тематика журналов: Humanities, Law, Life Sciences, Mathematics Sciences, Medicine, Social Sciences. ...

Еще в разделе: (Показать все результаты (>2) - wwwlib.phys.msu.ru/ )

• Библиотека физичеcкого факультета МГУ - Добро пожаловать

LUT Summer School: www.lut.fi/summerschool summerschool@lut.fi Guide for Student Advisers Greetings from your colleagues at Lappeenranta University of Technology! ... With the wide-ranging selection of courses on-offer during the LUT Summer School we aim to both challenge and inspire students. ... Lappeenranta and LUT Lappeenranta is located some 220 km northeast of Finland's capital, and about 230 km northwest of St. Petersburg, Russia. ... The fee will be given on the LUT Summer School web pages. ...

Еще в разделе: (Показать все результаты (>4) - www.phys.msu.ru/ )

Cell Biology International 27 (2003) 293­294 Cell Biology International www.elsevier.com/locate/jnlabr/ycbir Short communication Microtubule dynamics in living cells : direct analysis in the internal cytoplasm Ivan A. Vorobjev a a,* , Irina B. Alieva a, Ilya S. Grigoriev b, Gary G. Borisy c Laboratory of Cell Motility, A.N. Belozersky Institute, Moscow State University, Moscow, Russia b Department of ... These data demonstrate that MT growth is impeded at the cell margin. ...

Еще в разделе: (Показать все результаты (>25) - cellmotility.genebee.msu.ru/ )

... Научный календарь МГУ Научная жизнь на ФГУ Конференции Научные семинары Международная конференция ФГУ International Conference Молодым ученым Электронные ресурсы Список полнотекстовых баз данных (журналы) Список полнотекстовых баз данных (книги) Список реферативных баз данных Материалы международных конференций Архив мероприятий Конференции Научные семинары Круглые столы Презентации Международная конференция ФГУ Фестиваль науки Международное сотрудничество . ... Agricultural and Biological Sciences ...

Еще в разделе: (Показать все результаты (>26) - www.spa.msu.ru/ )

Cassa depositi e prestiti spa Long-Term Instruments for financing Infrastructure Franco Bassanini Chairman of Cassa Depositi e Prestiti Institute of the Russian Academy of Sciences September 22, 2010, Moscow Cassa depositi e prestiti spa Global capitalism and short-termism · The short-termism that characterized recent global capitalism had negative effects on the ...

Еще в разделе: (Показать все результаты (>15) - www.mse-msu.ru/ )

• http://www.mse-msu.ru/Nekipelov_France_2010_Slides_Eng.pdf
• http://www.mse-msu.ru/Russia_2010_MSE_en.pdf

Home . Database of structures of nucleic acid - protein complexes . ... List of complexes . Pfam families . SCOP families . Interaction classes . ... NPIDB . ... Information on SCOP and Pfam domains detected in protein chains is presented. ... Each family has its own web page with the list of entries that include domains of the family. ... List of SCOP domains occurred in DNA-protein and RNA-protein complexes is organized in tree-like form, according to the SCOP classification. ...

Еще в разделе: (Показать все результаты (>4) - npidb.belozersky.msu.ru/ )

Welcome to K -corrections calculator, simple service allowing one to determine K -corrections of a galaxy, given its redshift and one or more colours. ... K -correction in choose filter.. ... Redshift . Colour choose colour.. Colour value . Calculator . ... calculate spectral energy distributions , K-corrections calculator , GALEX FUV NUV , UKIDSS YJHK , K-corrections of galaxies , spectral based k-corrections , SDSS filter set K-corrections , K correction code IDL , kcorrect IDL C , . ...

Еще в разделе: (Показать все результаты (>6) - kcor.sai.msu.ru/ )

• K-corrections calculator (version 2010)

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>4) - mouse.genebee.msu.ru/ )

Langmuir 2005, 21, 8243-8249 8243 The "Wimple": Rippled Deformation of a Fluid Drop Caused by Hydrodynamic and Surface Forces during Thin Film Drainage Lucy Y. Clasohm,, Jason N. Connor,,| ... In Final Form: June 16, 2005 It is well-known that hydrodynamic pressures in a thin draining liquid film can cause inversion of the curvature of a drop or bubble surface as it approaches another surface, creating a so-called "dimple". ... WimplesRippled Deformation of a Fluid Drop Langmuir, Vol. ...

Еще в разделе: (Показать все результаты (>30) - nanofluidics.phys.msu.ru/ )

• Laboratory of Micro- and Nanofluidics

VARIABLE STARS, THE GALACTIC HALO AND GALAXY FORMATION C. Sterken, N. Samus and L. Szabados (Eds.) 2010 Formation Mechanisms for Spheroidal Stellar Systems O. K. Sil'chenko 1 Sternberg Astronomical Institute of the Moscow State University, Moscow, Russia Abstract. Spheroidal stellar systems on various scales include elliptical galaxies, dwarf spheroidal galaxies, and globular stellar clusters. ... The formation mechanisms of the oldest globular clusters represent a puzzle yet. ... 2009). ...

Еще в разделе: (Показать все результаты (>48) - sn.sai.msu.ru/ )

• Some important events

... 433-438 IMPRINTING ON NATIVE POND ODOUR IN THE POOL FROG, RANA LESSONAE CAM. ... To reveal the natural reaction of wild individuals of the pool frog to native pond water frogs (Group 1) were caught near their native pond at the end of metamorphosis, on stages 43-46 (Gosner, 1960), and were tested in a chamber 76 cm long, 12 cm wide and 15 cm high, made of white plastic and covered with a transparent glass. ... In tests wild frogs of Group 1 were offered native pond water paired with tap water. ...

Еще в разделе: (Показать все результаты (>47) - vertebrata.bio.msu.ru/ )

• Student Reports at International Conferences
• Выступления студентов и аспирантов на конференциях
• Background of the Department

DAYS on DIFFRACTION' 2011 77 Analytical solutions for diffraction problem of nonlinear acoustic wave b eam in the stratified atmosphere Vladimir A. Gusev, Ruslan A. Zhostkow Department of Acoustics, Physical Faculty, Lomonosov's Moscow State University, Russia; e-mail: vgusev@bk.ru The nonlinear wave equation and mo dified Khokhlov­Zab olotskaya typ e equation for high intensive acoustics wave b eams propagating in stratified atmosphere with inhomogeneous of sound sp eed is set up. ...

Еще в разделе: (Показать все результаты (>37) - acoustics.phys.msu.ru/ )

... Only by numerical simulation. ... moment T (K) Dipole moment (D) Experiment Other example: Diffusion constant 200 250 298 350 400 2.40 2.37 2.48 2.59 2.80 2.25 The Distribution functions: radial distribution function 1 g (r) = N t =1 j i N TS N pair ( r - rij ) The Distribution functions: radial distribution function CC def 2 Work mode ­ computer related 1) · Perform simulation , create trajectory file · Calculate properties timestep by timestep 2) · Perform ...

Еще в разделе: (Показать все результаты (>11) - www.elch.chem.msu.ru/ )

• http://www.elch.chem.msu.ru/mole/lecture/qprice.pdf
• Molecular aspects of solid state and interfacial electrochemistry

ВМиК-Online! ... Факультет . ... Абитуриенты . ... Вариант письменного вступительного экзамена . по английскому языку . Отделение бакалавров факультета ВМиК . ... They found that cannabis users are 40 percent less effective in fighting viruses than normal people. ... Группа В Контакте для абитуриентов ВМК МГУ: . Поступление на ВМК МГУ 2012 . Форум абитуриентов ВМК МГУ . ... Телефон приемной комиссии факультета ВМиК МГУ: . ... 2001 2012 ВМиК Online! ...

Еще в разделе: (Показать все результаты (>6) - www.cmc-online.ru/ )

• ВМиК - Online! : Работа для выпускников и студентов ВМК МГУ - Вакансии компании

Head of sector, acting head of the Computational Geophysics Division of the M.V. Keldysh Institute for Applied Mathematics, RAS. ... Finished the Electrodynamics and Quantum Theory Department of Faculty of Physics, MSU in 1962. ... Ill-posed problems, stochastic processes, theory of approximation. Mechanics and physics of multi-phase media, phenomena in porous media, difference schemes for some classes of mathematical physics problems (filtration, elasticity theory). ...

Еще в разделе: (Показать все результаты (>3) - compmech.math.msu.su/ )

О НЕУСТОЙЧИВОСТИ СХОДЯЩИХСЯ УДАРНЫХ ВОЛН ПОЛИГОНАЛЬНОЙ ФОРМЫ А.В. Конюхов, А.П. Лихачев Объединенный институт высоких температур РАН, Москва Как известно [1], сходящиеся цилиндрические (сферические) ударные волны неустойчивы по отношению к потере пространственной симметрии с тенденцией к возникновению полигональной (полиэдральной) формы. ... Whitham, G. B., 1974 Linear and Non-linear Waves. ... Schwendeman, D. W., Whitham, G. B. On converging shock waves // Proc. R. Soc. ...

Еще в разделе: (Показать все результаты (>15) - hit-conf.imec.msu.ru/ )

• http://hit-conf.imec.msu.ru/books/NeZaTeGiUs_2010.pdf

Международный учебно-научный лазерный центр МГУ им. М.В. Ломоносова . ... О МЛЦ МГУ . ... Абстракт: The current status of studies in the physics of entangled states of atomic systems Р an interdisciplinary field involving quantum optics, quantum information, and the foundations of quantum mechanicsРis reviewed. ... In the second part, experiments on the creation and detection of entangled states in atomic systems are discussed along with associated experimental proposals for their refinement. ...

Еще в разделе: (Показать все результаты (>29) - ilc.phys.msu.ru/ )

• Grant detail
• Грант подробно
• Conference

LabVIEW. ... National Instument DAQ, LabVIEW LPT COM , GPIB . ... RS-232 GPIB . RS-232 / GPIB, LabVIEW. ... RS-232 IEEE-488 (GPIB). ... RS-232 , DTE (Data Terminal Equipment) -- ( ), -- DCE (Data Communications Equipment) -- ( ). DTE () -- , DCE () -- , RS-232 (, , ), . ... LabVIEW, National Instruments http://ni.com/support/gpib/versions.htm. ... VISA Read COM Receive GPIB ), , . VISA Write Send COM GPIB . ... VISA Read Receive , «read buffer» ( «data string» GPIB) Create\Indicator. ...

Еще в разделе: (Показать все результаты (>3) - www.test.physchem.msu.ru/ )

ISSUE 1 RUSSIA U.S. BILATERAL ON CYBERSECURITY CRITICAL TERMINOLOGY FOUNDATIONS APRIL 2011 The Russia U.S. Bilateral on Cybersecurity ­ Critical Terminology Foundations Issue 1 The principle editors of this document are: Karl Frederick Rauscher, EastWest Institute and Valery Yaschenko, Information Security Institute of Moscow State University. ... INFORMATION AND CYBER .. ... Scientific Adviser to the Director of the Lomonosov Moscow State University Institute of Information Security Issues. ...

Еще в разделе: (Показать все результаты (>13) - iisi.msu.ru/ )

• http://www.iisi.msu.ru/UserFiles/File/bayern2009/global_dns.pdf
• http://www.iisi.msu.ru/UserFiles/File/bayern2016/InfoMessageEng2.pdf
• http://www.iisi.msu.ru/UserFiles/File/bayern2009/rewriting_the_narrative.pdf

... Alexey Garber Moscow State University April 17, 2010 A. Garb er (MSU) Quasicrystals April 17, 2010 1 / 33 Ё This work is a joint work with Dirk Frettloh from Bielefeld University. A. Garb er (MSU) Quasicrystals April 17, 2010 2 / 33 Separated net Definition A subset A of metric space M is called separated net if for some constants r and R following condition holds: for every two points x1 , x2 A distance dM (x1 , x2 ) r and for every point y M dM (y , A) R . ...

Еще в разделе: (Показать все результаты (>120) - higeom.math.msu.su/ )

• S.P.Novikov Seminar