ISSN 1560-3547, Regular and Chaotic Dynamics, 2015, Vol. ... The Dynamics and Control of a Spherical Robot with an Internal Omniwheel Platform Yury L. Karavaev1* and Alexander A. Kilin 1 2** M. T. Kalashnikov Izhevsk State Technical University, ul. ... The problem of control of spherical robot motion along an arbitrary tra jectory is solved within the framework of a kinematic mo del and a dynamic mo del. ... To describe the motion of a spherical robot, we consider three coordinate systems. ... Vol. ...

Еще в разделе: (Показать все результаты (>137) - ics.org.ru/ )

• http://ics.org.ru/upload/iblock/76b/2524.pdf
• http://ics.org.ru/upload/iblock/38e/121-euler-poisson-equations-and-integrable-cases_ru.pdf
• Institute of Computer Sciences - Publications

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>5) - mouse.genebee.msu.ru/ )

• ConClus

... West European and American literature and culture of XIX-XX centuries, literature as discourse, reception studies, history of the book . ... Moscow University Press, 1994. ... W. Stevens. тАУ History of American Literature. ... Board Member, Administrative Board of Moscow University . Board Member, Administrative Board of the School of Philology, Moscow University . Board Member, Specialized Dissertation Board for West-European and Slavic Literatures, School of Philology, Moscow University . ...

Еще в разделе: (Показать все результаты (>9) - discours.philol.msu.ru/ )

• Summer School 2016
• Events

... 000, 1ґ12 (2009) Printed 11 February 2010 A (MN L TEX style file v2.2) Analytical approximations of K -corrections in optical and near-infrared bands I1gor V. Chilingarian1 2 ,2,3 , Anne-Laure Melchior 1,4 and Ivan Yu. ... Received 2010 February 01; in original form 2009 August 14 ABSTRACT To compare photometric properties of galaxies at different redshifts, the fluxes need to be corrected for the changes of effective rest-frame wavelengths of filter bandpasses, called K -corrections. ... Table 1. ...

Еще в разделе: (Показать все результаты (>6) - kcor.sai.msu.ru/ )

• http://kcor.sai.msu.ru/arXiv1102.1159.pdf

... General Information . ... For physics faculty . ... Until 1939 in Moscow State University there was one undivided General Physics Chair. ... He was a leading scientist in the field of magnetic phenomena, and during 14 years the experimental and theoretical research of condensed matter magnetization, magnetic hysteresis and ferromagnetic resonance have been conducted under his leadership. ... In 2003 the Chair was renamed to Chair of General Physics and Magneto-Ordered Matter. ...

Еще в разделе: (Показать все результаты (>26) - ferro.phys.msu.ru/ )

• Special courses for the students of Physics Faculty, specialized at the...

LUT Summer School: www.lut.fi/summerschool summerschool@lut.fi Guide for Student Advisers Greetings from your colleagues at Lappeenranta University of Technology! ... With the wide-ranging selection of courses on-offer during the LUT Summer School we aim to both challenge and inspire students. ... Lappeenranta and LUT Lappeenranta is located some 220 km northeast of Finland's capital, and about 230 km northwest of St. Petersburg, Russia. ... The fee will be given on the LUT Summer School web pages. ...

Еще в разделе: (Показать все результаты (>4) - www.phys.msu.ru/ )

. Prague, August 16, 2006 . Present classification : Suggested: . No subtype: CV N, NA, NB N, Nhf (final helium flash; suggestions of a different designation are welcome) NR Nr, NSym (symbiotic Nova), UGWZ (see below) . NC NSym NL CV, UXUMa ('permanent outburst'), VY (VY Scl type, fadings from time to time) . CATACLYSMIC VARIABLES . AND OTHER STARS WITH OUTBURSTS

Еще в разделе: (Показать все результаты (>111) - sai.msu.ru/ )

• Конференции сайта АстрО
• GCVS Research Group: History and Persons.
• А С Т Р О К У Р Ь Е Р

... N.5, pp.592-597 (scanned PDF file, English version) . ... A.V.Shanin, Embedding formula for electromagnetic diffraction problem // Zapiski seminarov POMI, V.324, pp.247-261 (2001), in Russian, (PDF file, Russian version) (PDF file, English version) . ... PDF file) . ... Shanin A.V., Coordinate equations for the Laplace-Beltrami problem on a sphere with a cut // QJMAM, 2005 (58) 2, 1-20 The preprint versions of two previous papers have been sent to URSI contest: Paper 1, PDF file , Paper 2, PDF file ...

Еще в разделе: (Показать все результаты (>44) - acoustics.phys.msu.ru/ )

... Елена Фоменко (2 курс). ... Руководитель В. И. Буник, отдел биокинетики НИИ ФХБ им. А.Н.Белозерского МГУ. ... Руководитель А.Г. Евстафьева, отдел химии и биохимии нуклеопротеидов НИИ ФХБ им. А.Н. Белозерского МГУ. ... Руководитель Н.В. Чичкова, лаборатория молекулярной биологии гена отдела химии и биохимии нуклеопротеидов НИИ ФХБ им. А.Н. Белозерского МГУ. ... Руководитель А.Г. Евстафьева, лаборатория молекулярной биологии гена отдела химии и биохимии нуклеопротеидов НИИ ФХБ им. А.Н. Белозерского...

250. http://ecology.genebee.msu.ru/3_SOTR/CV_Terekhin_publ/2002_Host_manip_IJP.pdf

251. Публикация

252. http://www.test.physchem.msu.ru/doc/afe1.pdf

253. http://tex.bog.msu.ru/rustexeo.html

254. НЕСТАЦИОНАРНЫЕ РЕЖИМЫ ГЕНЕРАЦИИ В ПРОТОЧНЫХ ЛАЗЕРНЫХ СИСТЕМАХ И НОВЫЕ

255. Molecular mechanics study of the mixed-ligand lanthanide complexes using

256. General information

257. Журнал Московской Патриархии 12-2002

258. http://www.eng.math.msu.su/download/Abstract2014.pdf

259. Semantic Resources for Textual Content Compression

260. Anton O. Belyakov