... Simultaneous measurement of local heat transfer and pressure drag coefficients on a smooth surface and a surface with complex relief (dimples, projections, grooves etc.), flown over by subsonic air stream , with velocity range from 5 m/s to 120 m/s. Simultaneous measurement of local coefficients of heat transfer and pressure drag on smooth surface and ... Measurement of thermal protection efficiency with the use of porous cooling and gas curtains. ...
... ОПРЕДЕЛЕНИЕ КОНЦЕНТРАЦИИ ОКСИДА УГЛЕРОДА В ВОЗДУХЕ АТМОСФЕРЫ . ... Руководитель работы: учитель экологии Лысенкова Е.В. В воздухе атмосферы промышленных городов наряду с естественными примесями, . ... углерода в воздухе атмосферы в районе школы ? ... Для определения концентрации оксида углерода в атмосферном воздухе был . ... Зарегистрированный в пробах воздуха атмосферы уровень окиси углерода . ... Санкт-Петербург, АО НПП , 1997, 28 с. Definition of carbon oxide concentration in atmosphere air . ...
... Program for exploration of the continental shelf Workshop on black soot pollution in the Arctic Russia 's participation in supporting Arctic Council projects An idea for integrated sea management Russia 's cooperation with the OECD on the Environment Russian Seminar-meeting of heads of national parks Greenpeace on United Russia 's attitude towards nature reserves Solving the problem of solid household waste in the Moscow region Attitude to separate ...
[
Текст
]
Ссылки http://www.geogr.msu.ru/science/projects/our/ross_swed/NewsLETTER/10_11.pdf -- 572.4 Кб -- 21.12.2011 Похожие документы
Автор: strider . ... Кафедра психологии Обнинского института атомной энергетики предлагает Вам принять участие в исследовании, направленном на психометрическую проверку методики функционально-установочного баланса (ФУБ). Для этого Вам необходимо заполнить опросник . ... Приглашение принять участие в апробации опросника ФУБ . ... Флогистон / психологический блог / Приглашение принять участие в апробации опросника ФУБ . ... 2 Константин Ефимов . Иллюзия движения . ... Иллюзия ковра . ...
. Область научных интересов . Сотрудники, приглашенные специалисты и студенты . Информация о научных конференциях и семинарах . Основные публикации . Наш адрес . Home page .
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
Volume 163, number 2 FEBS 0973 November 1983 Diazepam inhibits cell respiration and induces fragmentation of mitochondrial reticulum Ivan A. Vorobjev and Dmitry B. Zorov A.N. Belozersky Laboratory of Molecular Biology and Bioorganic Chemistry, Moscow State University, 117234 Moscow, USSR Received 1 August 1983; revised version received 14 September 1983 Diazepam (70-150 µg/ml) significantly inhibits oxygen consumption by pig kidney embryo cells and causes the cellular ATP level to fall. ...
[
Текст
]
Ссылки http://cellmotility.genebee.msu.ru/html/articles/vorobjev83.pdf -- 1055.8 Кб -- 24.05.2002 Похожие документы
Lomonosov project . News . ... Mikhail Lomonosov . Scientific goals . ... Scientific equipment . ... July 8, 2012 . ... May 10, 2012 . The entrance control of cable system of scientific equipment ?Lomonosov? successfully completed. ... Input control tests of scientific equipment ?Lomonosov? devices is held in NIIEM. December 15, 2011 . Preparations for testing the dynamic module of scientific instruments for satellite ?Lomonosov? is finished. November 30, 2011 . ...
THE LABORATORY OF CHEMISTRY AND PHYSICS OF SENSOR AND SEMICONDUCTOR MATERIALS . ... The project aims to develop methods for the synthesis of vanadium dioxide films with low temperature phase transition metal-semiconductor junction, which is necessary for the development of flexible electronics devices, new types of sensors, optoelectronic converters, volatile memory elements with the possibility of a superdense recording information. ...
... Next Routine] [List of Routines] NAME: ADD_HEADER PURPOSE: addition information from FITS-headers MPFS-frames DESCRIPTION: The function computes the total exposure, mean value zenit distance and modified FITS header CALLING SEQUENCE: Result =ADD_HEADER( headers ) CATEGORY: reduction MPFS-data INPUTS: Headers = String array FITS-headers from the MPFS data OUTPUTS: Header = String array containing the header from the FITS file. ... OPTIONAL INPUT KEYWORD PARAMETERS: BEFORE = Keyword string name. ...
Faculty of Physics of Lomonosov Moscow State University . ... Department of Photonics and Microwave Physics is one of the largest departments of Faculty of Physics of Lomonosov Moscow State University . ... Our department holds annual conference on wave phenomena in nonhomogeneous media, physics and applications of microwaves in May in Moscow suburb. ... Physics of microwaves . ... Department of Photonics and Microwave Physics . Faculty of Physics . Lomonosov Moscow State University . ...
... обзор arxiv:1603.01463 Принципы интерферометрии (Interferometry concepts) . ... Comments: 35 pages, 13 figures. ... Авторы показывают, что нашумевшее несколько лет назад открытие легкой планеты вокруг одной из звезд альфа Центарва может быть связано с неправильным анализом данных. ... Comments: 24 pages, 19 figures, PPVI proceedings. ... Comments: 57 Pages, 26 Figures, 13 Tables . ... обзор arxiv:1207.3923 Управление исследовательскими данными в Большой науке (Managing Research Data in Big Science) ...
... Laboratory staff participate in the RFBR grant 14-01-00420-аА in 2014-2016. Laboratory staff participated in the RFBR grant 11-01-00523-аА in 2011-2013. ... A. Galstyan participated with poster . Poster . ... International Conference on Mathematical Modeling in Physical Sciences . ... International Conference on Mathematical Modeling in Physical Sciences, 2013, 1-5 September, Prague, Czech Republic . ... c) Laboratory of mathematical models of quantum scattering processes, 2012 . ...
... Содар . Профилемер . Соник 5 м . ... Профилимер ЗНС . ... Данные . ... Содар Профилемер Соник 5 м Соник 10 м Профилимер ЗНС . ... Если Вас заинтересовали наши данные, ображайтесь к нам . ...
Exchanges Exchanges with Moscow University . ... Exchanges . ... Students studying at partner universities may come as exchange students to Moscow University according to conditions set up by exchange agreements. ... Formal nomination letter signed by head of international office of home university. This letter shoull arrive in original and by fax to +7 (495) 9328960 or as scanned copy to e-mail of a proper coordinator . Personal application , also as original and by fax/e-mail. ...