... Родился 28 августа 1965 г. Окончил физический факультет Московского Государственного университета им. М.В. Ломоносова в 1988 г. Специальность по образованию - физик. 1995 г. - защитил кандидатскую диссертацию. ... E-mail: larichev@optics.ru . ... Goncharov A.S., Iroshnikov N.G., Larichev A.V., Nikolaev I.P., The impact of speckle on the measurement of eye aberrations, 2014, Journal of Modern Optics, ? ... PDF . ... Goncharov A.S., Larichev A.V., Iroshnikov N.G., Ivanov V.Yu., ...
... Gpu | ... 10 , MULtI- GPU ABSoft Neat Video Adobe After Effects CC Autodesk Flame Premium Boris FX Continuum Complete Cinnafilm Dark Energy Plug-in CoreMelt complete eyeon Fusion GenArts Monsters Gt GenArts Sapphire roBUSKEY Neat Video open FX NewBlueFX Video Essentials NewBlue titler Pro Pixelan AnyFX re:Vision Effects red Giant Effects Suite red Giant Magic Bullet Looks the Foundry HIEro the Foundry NUKE and NUKEX Video Copilot Software Element 3D ... Q=Quadro Gpu, T=Tesla Gpu. ...
[
Текст
]
Ссылки http://ccoe.msu.ru/sites/default/files/RU_Apps_Catalog_Sep13_LR.pdf -- 131.1 Кб -- 10.12.2013 Похожие документы
... Printed in U.S.A. AN EXTRA LONG X-RAY PLATEAU IN A GAMMA-RAY BURST AND THE SPINAR PARADIGM V. Lipunov1, 2, 3 and E. Gorbovskoy 1, 2, 3 Received 2007 May 3; accepted 2007 June 25; published 2007 August 6 ABSTRACT The recently discovered gamma-ray burst GRB 070110 displayed an extraordinar y X-ray afterglow with Xray radiation--i.e., an X-ray ... 2006; Wang & Meszaros 2007). ... It is followed by a slow collapse (the magnetic field is weak), which results in a weak X-ray burst. ...
[
Текст
]
Ссылки http://observ.pereplet.ru/images/evgeny/article/2007/ApjLettt.pdf -- 201.3 Кб -- 27.09.2007 Похожие документы
... Unit I. Geologic Hazards and Man Unit II. ... Amazing Earth. ... Трансформируйте словосочетания в предложения. 1. geologic processes going on for millions of years 2. any geologic process can become a geologic hazard 3. some geologic hazards having resulted in disaster 4. many geologic hazards have affected the activity of man 5. a lot of earthquakes resulting in landslides 6. some naturally occurring hazards 7. many disasters are caused by geologic hazards 8. some ...
[
Текст
]
Ссылки http://www.geol.msu.ru/obsh/uch_ch2.doc -- 389.0 Кб -- 08.04.2016
[
Текст
]
Ссылки http://geol.msu.ru/obsh/uch_ch2.doc -- 389.0 Кб -- 08.04.2016 Похожие документы
... Carbon and Nitrogen As Resources Limiting the Growth of Mono- and Mixed Cultures of Pseudomonas aeruginosa Dissociants P. V. Fursovaa, E. S. Mil'kob, and A. P. Levichc c Department of Biophysics Department of Microbiology Department of General Ecology, Moscow State University, Moscow, 119991 Russia e-mail: fursova @biophys.msu.ru b a Received December 26, 2006 Abstract--New experiments for detection of resources limiting the ... 1997; Levich, 2000). ... 1) (Levich et al., ...
... Recreational Geography and International Tourism . ... Physical Geography and Landscape Science . ... Science . ... According to the fact that ecological conflicts has a global scale in international watersheds, transboundary location of Selenga river complicates the problem of scientific resolution of the conflicts between water consumers. ... International programme in Natural Resource Management and Law offers a unique combination of Natural and Environmental Sciences and Science of Law. ...
In order to promote a better understanding of American life and institutions, the Bureau of Educational and Cultural Affairs (BECA) of the U.S. Department of State is offering six-week academic programs aimed at improving U.S. studies curricula abroad. Each Fulbright American Studies Institute focuses on a particular discipline of American studies or on a special topic within a discipline. ... Contemporary American Literature" . ... U.S. Political Economy and the Global Economic System" . ...
... Квантовая теория . ... Непертурбативная низкоэнергетическая физика адронов и лептонов (руководители - проф. К.А.Свешников, проф. А.Е.Дорохов). ... Методы квантовой теории поля в физике конденсированного состояния (руководители - с.н.с. О.В.Павловский, с.н.с. М.В.Улыбышев). Кафедра активно участвует в организации и проведении ежегодных международных семинаров по проблемам квантовой теории поля и теории гравитации в ИФВЭ - Протвино. ... Phys. Rev. D 85 (2012) 094022, arXiv: 1110.6059. ...
IEEE International Workshop on Intelligent Data Acquisition and Advanced Computing Systems: Technology and Applications 21-23 September 2009, Rende (Cosenza), Italy Web and Grid Services for Training in Earth Observation 1 Marian Neagul, Silviu Panica, Dana Petcu, Daniela Zaharie1, Dorian Gorgan 2 West University of Timisoara, Bd.V.Parvan ... CONCLU SIONS GiSHEO's platform promises to deliver real-time services for satellite data processing for training activities for Earth observation. ...
[
Текст
]
Ссылки http://angel.cs.msu.su/~oxana/image_processing/papers/2009-i09-104-final.pdf -- 1018.4 Кб -- 07.07.2009 Похожие документы
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... Изучение дискурса является сравнительно молодым, но активно развивающимся направлением современной лингвистики. ... Узел 2 «Действия гражданина в сфере религии» представлен единственным концептом (religious exercise / religious freedom) и не является объектом правового регулирования, а следовательно, и категоризации в судебном дискурсе, поскольку он относится к частной жизни индивидуума, представляет его неотъемлемое личное и гражданское право и регулируется религиозными, а не правовыми нормами. ...
[
Текст
]
Ссылки http://www.ffl.msu.ru/research/avtoreferats/127-shevyrdyaeva-avtoreferat.doc -- 156.0 Кб -- 02.02.2013
[
Текст
]
Ссылки http://ffl.msu.ru/research/avtoreferats/127-shevyrdyaeva-avtoreferat.doc -- 156.0 Кб -- 25.02.2013 Похожие документы
Рабочая программы дисциплины 1. Оптика композитных сред. ... Рассматриваются основные модели и приближения, применяемые для описания эффективного отклика композитных сред. ... Изучение основ статистического описания локальных полей в случайно- неоднородных средах. ... Общая трудоемкость, акад. часов |. ... Лабораторные работы, акад. часов |. Самостоятельная работа, акад. часов |. ... рассеяние |Функция Грина | ... поле излучения | ... Какие приближения используются при выводе формулы Гарнетта? ...
[
Текст
]
Ссылки http://quantum.phys.msu.ru/sites/default/files/downloads/122/optika-kompozitnyh-sred.doc -- 138.5 Кб Похожие документы
... About hotel . ... Rooms and prices . ... The hotel ?69th Parallel? is glad to present its renewed website which now has an option of online booking! ... The hotel ?69th Parallel? offers comfortable single and twin rooms and deluxe rooms relevant to the European standards. Every room has free WiFi connection. ... SINGLE STANDARD ROOM . Single occupancy ? 1 800 rub./day . ... 200 rub./person . ... 2 200 rub./day . ... The prices are in rubles for room a day and include the VAT (18%) . ...
... Abstract A Uniform Resource Identifier (URI) is a compact string of characters for identifying an abstract or physical resource. ... This document defines a grammar that is a superset of all valid URI, such that an implementation can parse the common components of a URI reference without knowing the scheme-specific requirements of every possible identifier type. ... URI-reference = [ absoluteURI | ... Otherwise, the reference URI's scheme is inherited from the base URI's scheme component. ...
Russian TeX Disk . ... Please, use "Save link as" (right mouse button) for downloading files, otherwise binary files will be corrupted. What is russian TeX disk . ... Some TeX versions and tools are installed/russified and can be started directly from CD; other are only distributives plus additional files for their russification. ... FPTEX . ... Directory russian.add: Generic files (mf-sources, pfb-fonts and hyphen file) for russification of any-TeX-realizations in: . ... file readme: . ...
ґ Universite catholique de Louvain ґ ґ Departement des Sciences economiques ` ґ ґ These presentee en vue de lobtention du grade de ґ docteur en sciences economiques Essays on economic dynamics under heterogeneity Anton O. Belyakov Composition du jury: Julio Davila (promoteur) Raouf Boucekkine Carmen Camacho Vladimir Veliov Mathieu Parenti Acknowledgements First of all I would like to thank my supervisors Raouf Boucekkine and Julio Davila. I'm grateful to other members of my doctoral jury: Mathieu Parenti,
... The earlier meaning assigned to ca- was `to set up, dedicate', while C. Melchert believes that verbs formed from this root can mean both `to promise, pledge' and `to agree, assent'.7 The verbal root o- also seems to refer to some sort of verbal activity.8 The root of the cognate stems i- and in- is probably the same as that of Hitt . ie- and Luw. - `to do, make', and the meaning of the Hittite and Luwian verbs suits the appropriate Lydian contexts.9 ... 7 Melchert 1997: 39-41. ... EWL ~ Lyd...
[
Текст
]
Ссылки http://www.imk.msu.ru/Structure/Linguistics/yakubovich/download/lydian.pdf -- 255.7 Кб -- 30.04.2010
[
Текст
]
Ссылки http://imk.msu.ru/Structure/Linguistics/yakubovich/download/lydian.pdf -- 255.7 Кб -- 30.04.2010 Похожие документы
Thunderstorms and Elementary Particle Acceleration . ... Conference . The first announcement . ... The Thunderstorms and Elementary Particle Acceleration (TEPA-2012) conference is the second one devoted to the studies of the extreme atmospheric effects connected with amplification of electric fields in the lower atmosphere. ... TEPA-2012 conference will be held from July 9 till July 11, 2012, just after the 23rd European Cosmic Ray Symposium also organized by MSU ( http://ecrs2012.sinp.msu.ru ) . ...
... PHYSICAL INSTRUMENTS FOR ECOLOGY, MEDICINE, AND BIOLOGY LaserElectron X-Ray Source for Medical Applications E. G. Bessonov, A. V. Vinogradov, and A. G. Tourianskii Lebedev Physical Institute, Russian Academy of Sciences, Leninskii pr. ... It includes two electron storage rings (E 50 MeV) placed in the vertical plane and two laser resonators located in the horizontal and vertical planes. ... Electrons can be injected into the storage rings singly or during several cycles through the injectors. ...