News of PARALLEL.RU par-news на list.parallel.ru . ... Следующее сообщение: PARALLEL.RU - Новости, выпуск #364 [25/03/2014] . ... Выпуск 362. 4 марта 2014 г. ------------- 15 марта заканчивается прием заявок на участие в 20-ой редакции списка Top50 самых мощных компьютеров СНГ. http ://top50.supercomputers.ru/ ------------- Открыта регистрация участников на Летнюю Суперкомпьютерную Академию 2014 года , которая пройдет в МГУ имени М.В.Ломоносова с 23 июня по 5 июля ...

Еще в разделе: (Показать все результаты (>64) - mail.parallel.ru/ )

• PARALLEL.RU - Новости, специальный выпуск [30/06/2009]
• PARALLEL.RU - Новости, специальный выпуск [17/11/2009]
• PARALLEL.RU - Новости, специальный выпуск [27/06/2012]

Sorry, Your browser does not support frames. To see context of this page you should update it. Sorry, Your browser does not support JavaScript. To see context of this page you should enable JavaScript or update browser.

Еще в разделе: (Показать все результаты (>9) - sbmg.geol.msu.ru/ )

• Ф-502
• Photoalbums
• Calendar Converter

See PublishedAPI for packages intended to be used by Plugin and Contrib authors, or browse all packages . ... Foswiki::Plugins::AntiWikiSpamPlugin - AntiWikiSpam plugin uses the shared Anti-spam regex list to check topic text when saving, refusing to save if it finds a match. ... They do this by declaring 'plugin handlers'. ... This module defines the singleton object that handles Plugins loading, initialization and execution. ... The plugins and the handlers are carefully ordered. ...

Еще в разделе: (Показать все результаты (>1356) - wiki.cs.msu.ru/ )

• InstantEnhancements < System < Foswiki

... Родился 28 августа 1965 г. Окончил физический факультет Московского Государственного университета им. М.В. Ломоносова в 1988 г. Специальность по образованию - физик. 1995 г. - защитил кандидатскую диссертацию. ... E-mail: larichev@optics.ru . ... Goncharov A.S., Iroshnikov N.G., Larichev A.V., Nikolaev I.P., The impact of speckle on the measurement of eye aberrations, 2014, Journal of Modern Optics, ? ... PDF . ... Goncharov A.S., Larichev A.V., Iroshnikov N.G., Ivanov V.Yu., ...

Еще в разделе: (Показать все результаты (>6) - medphys.phys.msu.ru/ )

... Квантовая теория . ... Непертурбативная низкоэнергетическая физика адронов и лептонов (руководители - проф. К.А.Свешников, проф. А.Е.Дорохов). ... Методы квантовой теории поля в физике конденсированного состояния (руководители - с.н.с. О.В.Павловский, с.н.с. М.В.Улыбышев). Кафедра активно участвует в организации и проведении ежегодных международных семинаров по проблемам квантовой теории поля и теории гравитации в ИФВЭ - Протвино. ... Phys. Rev. D 85 (2012) 094022, arXiv: 1110.6059. ...

Еще в разделе: (Показать все результаты (>4) - hep.phys.msu.ru/ )

... Геология >> Геотектоника | ... Добавить новое сообщение . ... Учебное пособие "Введение в тектонофизику". Гончаров М. А., Талицкий В. Г., Фролова Н. С. Ответ. ... Тезисы научной конференции ЛОМОНОСОВСКИЕ ЧТЕНИЯ, ноябрь 2011 года СЕКЦИЯ ГЕОЛОГИЯ: . ...

Еще в разделе: (Показать все результаты (>27) - phys.web.ru/ )

... The two main ways of financing a business, equity financing and debt financing, will be discussed in this chapter. Equity Financing Equity capital is the amount of money that you and/or your partners put into the business or raise from other investors. Equity is not debt. While investors share in the profits (or losses) of the business, their investment is not a loan. ... Debt Financing With your equity capital in place, you are now in a position to approach lenders for a business loan. ...

Еще в разделе: (Показать все результаты (>13) - innovation.msu.ru/ )

• Start-Up Company Development :: Управление инновационной политики и организации

PLAN of the main events of the Russian Rectors' Union (RRU) for 2008 |Statute events of the RRU | ... Session of RRU's Council |February | ... higher and post-graduate professional education"", in | ... Session of RRU's Council |June | ... and innovative activities of higher education institutions | ... Session of RRU's Council |September | ... Main activities of RRU's Council of Higher Education institutions' Presidents |1. ... Sessions of Science, Technology and Education Council under |Constantly | ...

Еще в разделе: (Показать все результаты (>16) - www.rsr-online.ru/ )

• http://www.rsr-online.ru/doc/norm/354.doc
• http://www.rsr-online.ru/doc/norm/78.doc

Cosmic Research, Vol. 42, No. 5, 2004, pp. 489ґ534. Translated from Kosmicheskie Issledovaniya, Vol. 42, No. 5, 2004, pp. 509ґ554. Original Russian Text Copyright ? 2004 by Panasyuk, Kuznetsov, Lazutin, Avdyushi, Alexeev, Ammosov, Antonova, Baishev, Belenkaya, Beletsky, Belov, Benghin, Bobrovnikov, Bondarenko, Boyarchuk, Veselovsky, Vyushkova, Gavrilieva, Gaidash, Ginzburg, Denisov, Dmitriev, Zherebtsov, Zeleny, Ivanov-Kholodny, Kalegaev, Kanonidi, Kleimenova, Kozyreva, Kolomiitsev, Krasheninnikov,

Еще в разделе: (Показать все результаты (>2) - solarwind.cosmos.ru/ )

• http://www.kosmofizika.ru/buri/vesel2.pdf

... 2 : 1 ґ , 2 ґ : 1 : 1) Define the subject of intercultural communication. What is the difference between intercultural and cross-cultural communication? ... 2) Define culture. ... Explain the role of metaphor in culture studies. ... 4) Enumerate the basic functions of culture. ... 13) Comment on the acute problems of intercultural communication in the modern Russian society 2 : 1) Was Edward Hall right to define communication as culture and culture as communication? ... 2) Define communication. ...

Еще в разделе: (Показать все результаты (>33) - ffl.msu.ru/ )

Experimentation and Personality , 1 Explicating the Black Box through Experimentation : Studies of Individual Differences and Cognitive Processes Howard Lavine Department of Political Science, SUNY ґ Stony Brook Stony Brook, NY 11794-4392 Howard.Lavine@sunysb.edu Corresponding Author Milton Lodge Department of Political Science, SUNY ґ Stony Brook Stony Brook, NY 11794-4392 Milton.Lodge@sunysb.edu James Polichak School of Law, University of Michigan ... The Authoritarian Personality. ...

Еще в разделе: (Показать все результаты (>10) - suny.msu.ru/ )

• http://www.suny.msu.ru/ru/ProgrBufMar2006.doc

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>3) - mouse.genebee.msu.ru/ )

• StructAlign help

... burberry outlet , understand you are compulsive by leaving the house, leave your cell phone at home, go shopping or visit a cartoon. ... 2016 С Днем Победы! ... win 7 ultimate product key Windows 8 key windows 7 key win 7 key windows 7 pro product key win 7 pro product key windows 7 activation key windows 7 ultimate product key windows 7 ultimate serial key windows 7 key online win 7 ultimate key win 7 serial keys Win 7 ultimate ...

Еще в разделе: (Показать все результаты (>33) - elana.sinp.msu.ru/ )

Cell. ... In cells overexpressing MycN, as well as cells in which MycN was switched off, a-TOS stimulated rapid entry of Ca2? into the cytosol, compromised Ca2? buffering capacity of the mitochondria and sensitized them towards mitochondrial permeability transition and subsequent apoptotic cell death. ... 4 Mitochondrial Ca2? accumulation in NB cells with different level of MycN expression. a Accumulation of Ca2? by mitochondria in digitonin-permeabilized MycN(?) cells. ...

Еще в разделе: (Показать все результаты (>4) - www.fbm.msu.ru/ )

... Исследователи химического факультета МГУ представили проект моделирования молекулярной динамики опасных вирусов . ... Владимир Пентковский, известный разработчик программно-аппаратных архитектур, заслуженный исследователь Intel, обладает большим опытом создания научных коллективов в России, США и Индии. ... 2003 2011 MsuNews.Ru Новости МГУ . ... Экспорт новостей (RSS) ...

Еще в разделе: (Показать все результаты (>16) - www.msunews.ru/ )

МГУ имени М.В.Ломоносова Русская версия . ... Section ?Psychology? ... 29 Feb 2016 . ... 15 Apr 2016 . ... Chair Yury P. Zinchenko, professor, Dean of the Faculty of Psychology MSU . ... Chair Yury P. Zinchenko, Dean of the Faculty of Psychology MSU, academician RAE . ... A.G.Asmolov chair of the department of Personal Psychology, academician RAE; . ... B.S.Bratus chair of the department of General Psychology, corresponding member RAE; . ... Actual problems of sport psychology and healthy lifestyle. ...

Еще в разделе: (Показать все результаты (>16) - conf.msu.ru/ )

... One can compare the positions of these singularities and their corresponding singular variables in the Feynman diagrams which contribute to the signal process under consideration, and to both reducible and irreducible backgrounds. ... For a standard analysis using cuts on variables, one should cut hard against the regions of singularities in the background singular variables while keeping the regions with singularities for the signal singular variables (see e.g. [8]). ...

Еще в разделе: (Показать все результаты (>8) - top.sinp.msu.ru/ )

• http://top.sinp.msu.ru/lev/cms5.ps

... Meetings/Murray . ... Тема: FreeBSD in the Enterprise: An Introduction for Linux Users . ... Freely available Unix-like operating system . ... Redistribution of source code must retain the above copyright notice, this list of conditions, and the disclaimer. ... The source tree can be checked out at any state, or corresponding to any release . ... Some wireless hardware vendors refuse to release specifications, so this is the only method to use such cards with an open source operating system. ...

Еще в разделе: (Показать все результаты (>34) - uneex.mithril.cs.msu.su/ )

• Index of /static/AltDocs_informatika2/Book2/ch_08_math/01_mathematica/03_solve
• Index of /static/GimpDoc_EnRu/images/math
• Index of

Head of sector, acting head of the Computational Geophysics Division of the M.V. Keldysh Institute for Applied Mathematics, RAS. ... Finished the Electrodynamics and Quantum Theory Department of Faculty of Physics, MSU in 1962. ... Ill-posed problems, stochastic processes, theory of approximation. Mechanics and physics of multi-phase media, phenomena in porous media, difference schemes for some classes of mathematical physics problems (filtration, elasticity theory). ...

Еще в разделе: (Показать все результаты (>5) - compmech.math.msu.su/ )

• Список публикаций - Е. Б. Кудашев - Кафедра вычислительной механики

... Cmbridge Structural Database (CSD): . ... 180 H - ґ180 O N L 180 O R H R ?? ; 800 ґ180 R, L ґ ., ... CSD ? ... x - , % P21 /c 1 174448 35.0 P1 2 115575 23.2 C2/c 3 40219 8.1 P212121 4 38988 7.8 P21 5 26880 5.4 Pbca 6 17473 3.5 Pna21 7 6989 1.4 Pnma 8 6032 1.2 Cc 9 5350 1.1 P1 10 4752 1.0 P21 /c 150000 14 12 P1 100000 ln(- ) P 0.183(2)Їx ґ1.28(5) 10 8 6 4 2 0 50000 C2/c, P21212 P21 Pbca 0 50 1 0 100 150 200 0 1 2 3 4 5 ln( ) ICSD PDB : , ?? (ICSD) 10 ( PDB ) 10 8 8 ln ( ) 0 50 100 150 ...

Еще в разделе: (Показать все результаты (>3) - www.soc-phys.chem.msu.ru/ )