IEEE International Workshop on Intelligent Data Acquisition and Advanced Computing Systems: Technology and Applications 21-23 September 2009, Rende (Cosenza), Italy Web and Grid Services for Training in Earth Observation 1 Marian Neagul, Silviu Panica, Dana Petcu, Daniela Zaharie1, Dorian Gorgan 2 West University of Timisoara, Bd.V.Parvan ... CONCLU SIONS GiSHEO's platform promises to deliver real-time services for satellite data processing for training activities for Earth observation. ...
[
Текст
]
Ссылки http://angel.cs.msu.su/~oxana/image_processing/papers/2009-i09-104-final.pdf -- 1018.4 Кб -- 07.07.2009 Похожие документы
Кафедра общей топологии и геометрии . ... Публикации . ... Сипачева О.В. , The Topology of Free Topological Groups, Journal of Mathematical Sciences, vol. 131, no. 4, 2005, pp. ... Сипачева О.В. , Топология свободной топологической группы, Общая топология и топологическая алгебра. ... Резниченко Е.А. , Сипачева О.В. , The Fr\'echet--Urysohn and $\alpha_2$-properties in separable spaces, groups, and locally convex spaces, 13th Summer Conf. on General Topology and Its Applications, Mexico, 1998, pp.~ ...
... Публикации . ... 1, 012506 DOI . ... 1, 012509 DOI . ... 1, 103598 DOI . ... Edge field emission of large-area single layer graphene Kleshch V.I., Bandurin D.A., Orekhov A.S., Purcell S.T., Obraztsov A.N. Applied Surface Science, Elsevier BV (Netherlands) DOI . ... Graphene Formation on Surfaces of Single Crystal Metals Shvets P.V., Soon J.M., Verger A., Obraztsov A.N Journal of Nanoelectronics and Optoelectronics, American Scientific Publishers (United States) DOI . ... Материалы, ? ...
Software on Data Processing . We Offer Statistical Software And . Software On Data Analysis And Processing. ... The package is intended for those, who doesn't have large experience in statistical analysis, but needs a quick and convenient data processing tool. ... Package provides full complex of registration and analysis methods, individual EKG monitor-analyzer, special tools for complete polygraph analysis. price: 700$ - 2200$. phone number (095) 437-3695, 155-1365 . ... InCo . ...
Научная Библиотека . Отдел Обслуживания Физического Факультета МГУ . ... Электронные ресурсы . ... Ресурсы МГУ . ... Сайт Библиотеки МГУ . ... Напоминаем Вам, что каждый, кто пользуется доступом к журналам в электронном виде, как из помещений библиотеки, так и со всех компьютеров физического факультета не может прямо или косвенно использовать просматриваемые и сохраняемые материалы для: . ... Тематика журналов: Humanities, Law, Life Sciences, Mathematics Sciences, Medicine, Social Sciences. ...
... Студенческая Астрономическая обсерватория ГАИШ . ... Любителям астрономии . ... Структура ГАИШ : Отдел внегалактической астрономии : . ... The head of the group was born on October the 3rd, 1941 in the Yaroslavl' region of Russia and twenty-three years later graduated from the Faculty of Physics in the Moscow State University. ... 1989), Professor of astrophysics and stellar astronomy at the Faculty of Physics in MSU (1990). ... 2005, Astronomy Letters, 31 , 160 . ... chernin@sai.msu.ru . ... Staff ...
... О кафедре . ... КРИВОНОЖКО Владимир Егорович (11.06.1948, г. Москва) д.физ.-мат.н., профессор МФТИ, зав. кафедры АСУ МИСИС. ... Krivonozhko V. E., F rsund F. R. Lychev A. V. Terminal units in DEA: Definition and Determination // University of Oslo. ... F rsund F. R., Krivonozhko V. E., Lychev A. V. Hidden Effects in DEA Models //Differential Equations. ... Krivonozhko V. E., F rsund F. R., Lychev A. V. Some Ulterior Effects in the DEA models // Abstracts of the INFORMS Annual Meeting. ...
... The philosophical consequences of synergetics, the interdisciplinary theory of evolution and self-organization of complex systems, are being drawn in the paper. ... Key words: complex systems, evolution, nonlinearity, pre-determination, self-organization, soft management, structure-attractors, synergetics 1. ... The spectra of possible, `allowed' structures correspond to sets of the eigenfunctions of the nonlinear equations describing the evolutionary processes in the complex system. ...
[
Текст
]
Ссылки http://www.students.chemport.ru/materials/Philosophy/orph.pdf -- 61.0 Кб -- 15.01.2009 Похожие документы
... Публикации 2015 года . ... 2563496, 25 августа 2015 г. Тезисы докладов: . ... Москва: ЦИАМ им. П. И. Баранова, 2015. ... Волны в вязкоупругом слое, расположенном под слоем движущейся жидкости // Тезисы докладов VIII международной конференции 'Лаврентьевские чтения по математике, механике и физике'. ... Публикации 2014 года . ... Секция механики. 14 - 23 апреля 2014, Москва, МГУ имени М. В. Ломоносова. ... Публикации 2013 года . ... Секция механики. 15-23 апреля 2013, Москва, МГУ имени М.В.Ломоносова...
The Department of Talented Youth Affairs and Professional Orientation . ... August 20, 2014 Moscow State University hosted a video conference between the Centre for Development of electronic educational resources MSU and distance learning centers in Dagestan. The videoconference was held as part of a new project of MSU ?University without borders? ? ... 2016 - The Department of Talented Youth Affairs and Professional Orientation ...
... БИБЛИОТЕКА НИИЯФ МГУ . ... Полный список журналов ELSEVIER и SpringerLink доступных в 2011 году . ... Электронные ресурсы НИИЯФ МГУ . ... Acta Physica Hungarica, New Series, Heavy Ion Physics . ... Applied Physics Letters . ... аннотации . ... Astrophysical Journal, Astrophysical Journal Letters, Astrophysical Journal Supplement series . ... Journal of Physical Chemistry A . ... The European Physical Journal - Applied Physics . ... The European Physical Journal E: Soft Matter and Biological Physics ...
... Ключевые слова: МГУ имени М.В. Ломоносова, антропология, тип кисти, пальцевой индекс, диагностика половой принадлежности, корреляционные связи остеометрических признаков . ... Материалом для исследования послужили результаты комплексного обследования спортсменок высшей категории (сборная России по самбо) и учащихся московских ВУЗов (контрольная группа), профессионально не занимающихся спортом. ... Ключевые слова: МГУ имени М.В. Ломоносова, антропология, дискретно-варьирующие признаки, андаманцы . ...
... Opportunities for Research Section Financial and Legal Mechanisms for Developing Russia in the Context of Global Political and Economic Instability Chairperson: Professor Alla Bobylyova Head, Department of Financial Management, School of Public Administration Lomonosov Moscow State University Secretary: Olga Lvova Department of Russian History, School of Public Administration Lomonosov Moscow ...
[
Текст
]
Ссылки http://www.spa.msu.ru/uploads/files/konferenzii/_program_conference_2013_eng.pdf -- 326.1 Кб -- 21.05.2013 Похожие документы
яЛП . id #358 . Particle Particle Systems Characterization [not defined] . Common information . Periodicy: . [no information] . Impact-Factor: . [no information] . ISSN: . 1521-4117 . In print: . since 1998-01-01 till today . Language: . en . Price: . subscription - $1354,single article - $1 . Classifier: . [no at all] . Published by . (4) . Wiley Interscience - roboUpdate . No homepage defined . No open resources defined . Close . Complain . Edit
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... VaST is a software tool for finding variable objects on a series of astronomical images. ... VaST performs object detection and aperture photometry using SExtractor on each image, cross-matches lists of detected stars, performs magnitude calibration with respect to the first (reference) image and constructs a lightcurve for each object. ... VaST FITS image viewer ./pgfv . ... Part I" PZP, vol. ... K. V. Sokolovsky, S. A. Korotkiy; "New Variable Stars Discovered by the NMW Survey" PZP, vol. ...
... Recreational Geography and International Tourism . ... Physical Geography and Landscape Science . ... Science . ... According to the fact that ecological conflicts has a global scale in international watersheds, transboundary location of Selenga river complicates the problem of scientific resolution of the conflicts between water consumers. ... International programme in Natural Resource Management and Law offers a unique combination of Natural and Environmental Sciences and Science of Law. ...
Russian TeX Disk . ... Please, use "Save link as" (right mouse button) for downloading files, otherwise binary files will be corrupted. What is russian TeX disk . ... Some TeX versions and tools are installed/russified and can be started directly from CD; other are only distributives plus additional files for their russification. ... FPTEX . ... Directory russian.add: Generic files (mf-sources, pfb-fonts and hyphen file) for russification of any-TeX-realizations in: . ... file readme: . ...
... Here is a brief outline of the current theory of the events in the early history of the solar system: . A cloud of interstellar gas and/or dust (the "solar nebula") is disturbed and collapses under its own gravity. ... The gas cools off enough for the metal, rock and (far enough from the forming star) ice to condense out into tiny particles. (i.e. some of the gas turns back into dust). ... Once the larger of these particles get big enough to have a nontrivial gravity, their growth accelerates. ...