LOCAL TSUNAMI WARNING AND MITIGATION ________________________________________________________________________________________________________________________________________ Recommendations of the International Workshop "Local Tsunami Warning and Mitigation" Petropavlovsk-Kamchatskiy, Russia, September 10 - 15, 2002 Analysis of the state-of-the-art of the local tsunami participants testifies to the potential of a significant methodology and hazard reduction. ...
... B.V. Somov . head of the department . ... room 80 . ... senior research felow . ... research felow . ... research fellow . ... Our department performes the following most perspective studies: . Special analytical and numerical experimental investigations of the solar plasma involved in the magnetic reconnection process at the Sun. ... Head of the seminar: Prof. B.V. Somov. ... 27 September 2013 The Solar Physics Department was visited by journalists of the leading Russian TV channel "Vesti-1". ...
... Department of Computational mathematics and cybernetics , Lomonosov Moscow State University . ... Thesis title "Machine learning approach for automatic performance tuning of parallel program", supervisor Dr. Nina N. Popova. ... High-performance computing, automatic performance tuning, machine learning algorithms, evolutionary and bio-inspired programming, parallel algorithms in VLSI design . ... Algorithms and framework for automatic selection and tuning parameters of parallel sparse linear solvers....
News Archive . ... SUNY delegation headed by Interim Chancellor Admiral John R. Ryan to visit Moscow State University. ... The SUNY Center on the United States and Russia at Moscow State University was opened in a ceremony hosted by Rector Sadovnichy of MSU and Chancellor Robert King. ... Both sides agreed to a SUNY-MSU rematch in 2002. ... On January 15, 2001 a new MSU Co-Director of the SUNY Center on Russia and the United States, Dr. Nikolai V. Semin will begin performing his duties at the office. ...
... The 2016 Beacon Satellite Symposium will be held at the International Centre for Theoretical Physics (ICTP) at Trieste, Italy, from 27 June to 1 July 2016. ... Абстракты - 15/02/2016 . Подробнее на сайте: http://t-ict4d.ictp.it/beacon2016 . Конференция "Распространение радиоволн" имеет более чем 40-летнюю историю и проводится раз в два-три года в центральных городах России. 15 декабря 2015 г. - начало регистрации участников и представления текстов докладов . ... D.Физика атмосферы . ...
Lomonosov Moscow State University FACULTY OF ARTS 2011 ALEXANDER LOBODANOV DEAN OF THE FACULTY OF ARTS WxtЊ vҐЂЂxtzтxс4 g{x YtvтЂрч Ґy TЊрс уxЊx tvvx¶рxw |° ... Since 2003 he has been chairman of the Department of Semiotics and the General Theory of History, founded by him, the first of its kind in Europe. ... Department of Semiotics and the General Theory of Arts The Department of Semiotics and the General Theory of Arts is a theoretical department. ... Galina Zadneprovskaya manages this department. ...
... СУНЦ МГУ . ... Краткая информация . ... Материалы экзаменов 1-го тура прошлых лет . ... Кафедры . ... Сотрудники . ... Кафедра химии . ... Сезонные школы СУНЦ МГУ . ... Олимпиадные сборы СУНЦ МГУ . Интернет-ресурсы СУНЦ МГУ . ... Заочная школа СУНЦ МГУ . ... Главная Подразделения Кафедры Кафедра химии Chemistry Chair . Chemistry chair of AESC MSU was founded at 13 November 1989 by professor of MSU Chemistry department Yu. ... Natalia Igorevna Morozova, docent, PhD (Chem.) ... Chemistry Chair . ...
A program for automatic detection of aligned blocks in multiple protein alignment. Paste your alignment in fasta-format here: . ... The program works slow - it takes 8 seconds to process alignment of 6 sequences of length 500. The program's development is supported by Russian Foundation for Basic Research (grant 10-07-00685-a) and Ministry of Education and Science of the Russian Federation (State Contract No. 07.514.11.4006). ...
The revision of the MASS/DIMM star catalogue N. Shatsky, V. Kornilov March 16, 2008 Abstract The compilation of the (updated) version of the MASS (MASS/DIMM) device target catalogue is described. ... Then the list was cleaned according to following criteria: I. Remove stars too faint for a MASS device. ... Here the color equation of the Sternb erg device was taken: M AS S mag = V mag + 0.45 (B - V ); stars with M AS S mag > 3.2 were removed. ... This was made based on the GCVS4.2 catalogue data. ...
... Expanding and Retaining Customer Loyalty with Stefan Legner of InterNetX . Legner started with a brief history of InterNetX, a Regensburg, Germany based hosting and domain registrar provider that has more than 19,500 customers worldwide.He emphasized the need for companies to build long term partnerships, adding that business has always been about the relationship between people rather than companies .Where possible, Legner said that companies should provide an ... cheap the north face . ...
... Air temperature in the forechamber: 285-295K . ... Aerodynamic unit AR-2 is used for experimental research of heat and mass exchange processes in a model boundary layer, flown over by supersonic air stream. The main part of the unit is supersonic aerodynamic tube of continuous action with regulated plate nozzle, rectangular cross-section of the working part 100x70 and with regulated exit cone. ... Unit AR-2 is a supersonic aerodynamic tube with a regulated supersonic nozzle and an exit cone. ...
... Siberian Lang . Minority languages of Siberia as our cultural heritage . ... The project ?Development of the web-site ?Minority languages of Siberia as our cultural heritage? (on the material of the languages of the basin Middle Yenisei and the Middle and the Upper Taz)? was realized at the Laboratory for Computational Lexicography, Research Computing Centre, Lomonosov Moscow State University, with financial support from Russian Foundation for the Humanities, grant 12-04-12049.љ ...
... The Council on Complex Problems of Cosmic Rays of the Russian Academy of Sciences and the Skobeltsyn Institute of Nuclear Physics (SINP) of Lomonosov Moscow State University are planning to held a workshop "Cosmic Ray Physics Large Scale Experiments at the Second Decade of the 21st Century" on May 16-18 2011 at the Moscow State University. ... The Workshop banquet will be held on Tuesday, May 17 th . ... Workshop тАЬCosmic Ray Physics Large Scale Experiments at the Second Decade of the 21st Century"...
... Master . ... Participants . ... Zel'dovich asteroid . ... YaB-100 conferences . ... Gnedin Yu.N. Investigation of vacuum polarization in strong magnetic fields of neutron stars: Zel'dovich ideological impetus . ... Doroshkevich A.G. Beyond the limits of the LambdaCDM cosmology . ... Illarionov A.F. Title is discussed . ... Imshennik V.S. Title is discussed . ... Polnarev A.G. Polarization of CMB generated by Cosmological Gravitational Waves . ... Ruzmaikin A.A. A game of chance . ...
SUNY-MSU Partnership . ... MSU | ... The State University of New York/Moscow State University partnership dates back to the mid-1970s and owes its existence to the vision of then MSU Rektor Rem Kokhlov and SUNY Chancellor Ernest L. Boyer. ... The first students were exchanged in 1977. ... A SUNY Center on Russia and the United States opened its doors in January 2000, and a sister MSU Center on the United States and Russia was set up in Moscow at MSU?s newly built Science Park. ... suny-msu . ...
M obile A stronomical Sy stem of TE lescope- R obots MASTER-II Kislovodsk Lomonosov Moscow State University, Sternberg Astronomical Institute , Moscow Union "Optic" , Kislovodsk Solar Station Latitude = 43 o љ44'.767љN; Longitude = 42 o љ31'.417љE; Altitude = 2067љm MASTERљIIљ(8љsquareљdegress) + MASTERљVWF(VeryљWideљFieldљCameras (FOV=800 square degrees, Timeљresolutionљupљtoљ150љms, with unfiltered m_lim=14m on 5 sec. exposure, and ~10.5m with 0.15 sec) . ... 11h 38m 38.0s , -09d 59m 59s) . ...
Alexander P. Seyranian . Institute of Mechanics , . Moscow State Lomonosov University , . ... Phone: (7495) 939 2039 . Fax: (7495) 939 0165, 939 2065 . ... My field of specialization are Stability Theory, Parametric Resonance, Gyroscopic Stabilization, Mechanics of Solids, Structural Optimization, Singularities and Bifurcations. ... Technical University of Denmark . Aalborg University, Denmark . ... Institute of Engineering Mechanics and Systems, University of Tsukuba, Japan . ...
... Инновационная . структура МГУ . ... Обучение инновационному менеджменту . ... Нормативно-правовая база инновационной . деятельности . ... Process of Forming a Company . ... Finance for Start-Up . ... 2005 Управление инновационной политики . и организации инновационной деятельности . МГУ им. М.В. Ломоносова . ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы