XAFS spectroscopy is widely used in physics, materials science, chemistry (especially in catalysis and coordination chemistry), biology, geochemistry and environmental science. ... This is an interface to the Glimpse -based search engine which enables you to find published papers in different fields of x-ray absorption spectroscopy -- XAFS, EXAFS, XANES, NEXAFS, SEXAFS, XEOL, and EXAFS-like phenomena in photoemission, electron-energy-loss spectra and so on. ... Database Search Form . ...

Еще в разделе: (Показать все результаты (>3) - scon155.phys.msu.ru/ )

... The RADEN data bank produced at the Department of Chemistry of Moscow State University is designed as well to accumulate published information on radiative parameters of diatomic molecules, as to analyse it and recommend the more reliable values. ... electronic transition moments D ( R ); . ... dipole moments, . ... FACTUAL RECOMMENDED DATABASE contains now the ab initio and experimental electronic transition moments for more than 250 band systems which belong to more than 100 diatomic molecules. ...

Еще в разделе: (Показать все результаты (>61) - electr003.chem.msu.ru/ )

... Query = PYRB_ECOLI P0A786 Aspartate carbamoyltransferase catalytic chain (EC 2.1.3.2) (Aspartate transcarbamylase) (ATCase). (311 letters) Database: pm 204 sequences; 2,269,587 total letters Searching..................................................done Score E Sequences producing significant alignments: ( bits ) Value embl |AE006119|AE006119 Pasteurella multocida subsp . multocida st... 77 9e-16 embl |AE006208|AE006208 Pasteurella Pm70 section 86 of 204 of the complete genome. ...

Еще в разделе: (Показать все результаты (>7927) - kodomo.fbb.msu.ru/ )

• http://kodomo.fbb.msu.ru/~element/Term3/blast_3.txt
• http://kodomo.fbb.msu.ru/~smivic/Projects/Term_3/Downloads/gluq_pm.blast
• http://kodomo.fbb.msu.ru/~element/Term3/gomolog.txt

Электронная библиотека Попечительского совета . ... Michalski B. - Perl Database Programming . ... Название: Perl Database Programming . ... Here's your in-depth guide to creating database-driven applications using Perl. In this authoritative reference, Perl expert Brent Michalski uses plenty of examples to help you master Perl's capabilities in database applications with MySQL, PostgreSQL, and Oracle. ... Электронная библиотека попечительского совета мехмата МГУ , 2004-2016 . ...

Еще в разделе: (Показать все результаты (>8254) - lib.mexmat.ru/ )

• Price J. - Mastering C# Database Programming :: Электронная библиотека
• Muller К.J. - Database Design For Smarties: Using UML for Data Modeling ::
• Williams K. (ed.) - Professional XML Databases :: Электронная библиотека

... Query= sp|P0AAI3|FTSH_ECOLI Cell division protease ftsH OS=Escherichia coli (strain K12) GN=hflB PE=1 SV=1 (644 letters) Database: pm 204 sequences; 2,269,587 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value AE006080 Pasteurella multocida subsp. multocida str. Pm70 sectio.. ... Pm70 sectio... 48 2e-06 AE006234 Pasteurella multocida subsp. multocida str. ... Pm70 section 47 of 204 of the complete genome. ...

Еще в разделе: (Показать все результаты (>2534) - kodomo.cmm.msu.ru/ )

• http://kodomo.cmm.msu.ru/~plazmoliz/Term3/sup/swiss_result.txt
• http://kodomo.cmm.msu.ru/~plazmoliz/Term3/sup/pyr_D.txt
• http://kodomo.cmm.msu.ru/~jesus_crist/output.txt

... About lab . ... Online Journal "Computer graphics and multimedia" (in russian) . ... Image Database Retrieval by Fast Hermite Projection Method . ... http://graphics.cs.msu.ru/en/publications/text/gc2005kk.pdf . ...

Еще в разделе: (Показать все результаты (>785) - graphics.cs.msu.ru/ )

• High quality stereo-to-multiview generation | Graphics and Media Lab
• Temporal filtering for depth maps generated by Kinect depth camera | Graphics
• Temporal Post-processing Method for Automatically Generated Depth Maps |

... Alexey D. Neverov . ... Department of Bioengineering and Bioinformatics, Moscow State University. State Scientific Center GosNIIGenetika. ... EDAS human . EDAS mouse . EDAS dog (not availible now) . EDAS rat (not availible now) . To navigate this site please install the latest version of Macromedia Flash Player for Windows or for Linux . If you do not wish to install Flash you could use text pages with less functionality. ...

Еще в разделе: (Показать все результаты (>6) - edas2.bioinf.fbb.msu.ru/ )

• Alternative Splicing DataBase.
• EDAS (human) - Alternative Splicing DataBase.
• EDAS (mouse) - Alternative Splicing DataBase.

... use prefix && EPREFIX= has "${EAPI:-0}" 0 1 2 && ! use prefix && EROOT="${ROOT}" if [ -x "${EPREFIX}/usr/bin/update-desktop-database" ] then einfo "Updating desktop mime database .. EPREFIX}/usr/bin/update-desktop-database" -q "${EROOT}usr/share/applications" fi } # @FUNCTION: fdo-mime_mime_database_update # @DESCRIPTION: # Update the mime database. ... use prefix && EROOT="${ROOT}" if [ -x "${EPREFIX}/usr/bin/update-mime-database" ] then einfo "Updating shared mime info database .. ...

Еще в разделе: (Показать все результаты (>20167) - mirror.msu.net/ )

• http://mirror.msu.net/pub/slackware-current/slackware/l/libdiscid-0.6.1-i486-1.txt
• http://mirror.msu.net/pub/gentoo-portage/mail-filter/sqlgrey/sqlgrey-1.7.6-r1.ebuild
• http://mirror.msu.net/pub/gentoo-portage/www-apps/redmine/redmine-2.6.10.ebuild

Database: . ... Affymetrix official site . ... Clone/Gene ID converter . ... Probe set search: . Affymetrix probe set identifier example: "238900_at" . ... Search . Text search: . Gene official symbol (*-wildcard) example: "c1orf*" . Word or phrase in gene official name example: "receptor" . ... Gene search: . ENSEMBL gene identifier example: "ENSG00000026508" . NCBI Entrez Gene identifier example: 7503 . HUGO gene identifier example: 1681 . ...

Еще в разделе: (Показать все результаты (>8) - mouse.belozersky.msu.ru/ )

Next: Delivering Messages to Local Up: Routing Messages Previous: Routing Messages . smail expects to find the pathalias database in the paths file below /usr/lib/smail. This file is optional, so if you don't want to perform any pathalias routing at all, simply remove any existing paths file. paths must be a sorted ASCII file that contains entries which map destination site names to UUCP bang paths. The file has to be sorted because smail uses a binary search for looking up a site. ...

Еще в разделе: (Показать все результаты (>299) - itpm.msu.su/ )

• nn Configuration
• MySQL Reference Manual for version 3.23.10-alpha. - A Some MySQL users
• Getting Acquainted with NIS

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>17) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/megablast.out

. ЭКОЛОГИЧЕСКАЯ ИНФОРМАЦИЯ . WEB- ориентированная библиографическая база данных .

Еще в разделе: (Показать все результаты (>5) - ecoinformatica.srcc.msu.ru/ )

PHP Manual . ... Persistent connections are SQL links that do not close when the execution of your script ends. ... People who aren't thoroughly familiar with the way web servers work and distribute the load may mistake persistent connects for what they're not. ... For example, if you had 20 different child processes that ran a script that made a persistent connection to your SQL server, you'd have 20 different connections to the SQL server, one from each child. ... Connection handling . ...

Еще в разделе: (Показать все результаты (>503) - oit.cmc.msu.ru/ )

• Database (dbm-style) abstraction layer functions
• What can PHP do?
• FrontBase Functions

You can search database for submitted information. ... Character * specifies arbitrary character sequence (eg. '*n' will result: John, Martin etc.) Character * is placed at end of line automatically ('Mar*' = 'Mar' will result: Martin, Martina etc.) Blank form will result ALL database records. ... Family name: . ... Topic: . ... Seismo-tectonics of Tsunami 3. Numerical and Analytical Models of Local Tsunami Behavior 4. ... Recent Local Tsunamis 8. ... Information . ... Database search . ...

Еще в разделе: (Показать все результаты (>32) - seac47-2.phys.msu.ru/ )

• LOCAL TSUNAMI WARNING AND MITIGATION -- Proceedings Download Page

About BAFIZ . ... BAFIZ is a program devoted to the development of a distributed network of the knowledge and data bases for research of fundamental properties of the matter and applied nuclear physics. The project sponsored by Russian Foundation of Basic Research , RFBR reference number is 95-07-19502. ... This Page is developed at Laboratory of Computational Mathematics, . ... Last updated on 2 September 1999 . Copyright 1999 Laboratory of Computational Mathematics (DRCM) ...

Еще в разделе: (Показать все результаты (>22) - dbserv.sinp.msu.ru/ )

Genesis of carbonatites : inferences from a world map and database . ... The repetition of carbonatite emplacement in restricted areas of continental lithosphere/plate, which have generally drifted considerable distances between episodes of carbonatitic volcanism, must preclude any genesis involving mantle plumes, and underlines the crucial role that the lithosphere undoubtedly plays in carbonatite generation. ... Carbonatite occurrences of the world: map and database. ...

Еще в разделе: (Показать все результаты (>556) - geo.web.ru/ )

• Database of Raman spectroscopy, X-ray diffraction and chemistry of minerals -
• Mineralogy Database - Все о Геологии (geo.web.ru)
• Geochemical Rock Database - Все о Геологии (geo.web.ru)

Data are provided with the intent that they are readily available for personal and public non-commercial use and may be reproduced, in part or in whole and by any means, without charge or further permission from IWSG. However, proper reference to contributors of original data to the database must be provided in all cases, and due diligence should be exercised in ensuring the accuracy of the materials reproduced . ... Bird species report. In : ARCTIC BIRDS breeding conditions survey . ...

Еще в разделе: (Показать все результаты (>3) - arctic.ss.msu.ru/ )

• BIRDS SPECIES DATABASE of the Arctic Birds Breeding Conditions Survey

Experience with OO Database for CMS Events Distributed Between Two Sites. ... Participation of Russian institute (5% of all CMS simulations): Spring 2000 year - SINP MSU + ITEP - 50000 events , 25 GB transferred to CERN Autumn 2000 year - SINP MSU + ITEP + JINR - 110000 events , 180 GB transferred to CERN Autumn 2001 year - ( SINP +RRC)+ ITEP + JINR +FIAN - 270000 events , OO Database distributed between SINP and ITEP ~200 GB ...

Еще в разделе: (Показать все результаты (>44) - acat02.sinp.msu.ru/ )

Выберите категорию обращения: Общие вопросы Отчеты Рейтинги Диссертационные советы Конкурсы Ввод данных Структура организаций Пользователи Проблемы с регистрацией\входом в систему . ... Войти в систему . ... Kireeva N. , Baskin I.I. , Gaspar H.A. , Horvath D. , Marcou G. , Varnek A. в журнале Molecular informatics , издательство Wiley-VCH Verlag (Weinheim, Germany, Germany) , том 31, ? ...

Еще в разделе: (Показать все результаты (>1899) - istina.msu.ru/ )

• Marcou Gilles - сотрудник | ИСТИНА - Интеллектуальная Система Тематического
• Advances in database technology : proceedings. International Conference on
• International Journal of Intelligent Information and Database Systems - журнал

. Please use the reference to MASTER DataBase as Lipunov et al., 2010, MASTER Robotic Net, Advances in Astronomy, vol. 2010, pp. 1-7 . - days . MASTER , 2002-2016

Еще в разделе: (Показать все результаты (>3) - apollo.sai.msu.ru/ )

• Dome Kislovodsk Database ::
• Astelco Kislovodsk Database ::