... Graduated from M.Lomonosov Moscow State University, Department of Mechanics and Mathematics. Dissertation's title of Ph.D. (Phys.& Math): "Aerodynamic Characteristics, Shape-Formation and Stressed-Strained State of Parachute Canopy." ... Graduated from M.Lomonosov Moscow State University, Piano Class. ... Development of mathematical models and parameter computation methods for the shape, aerodynamic drag and stressed-strained state of parachutes with different canopy geometry. ...

Еще в разделе: (Показать все результаты (>6) - margaret.imec.msu.ru/ )

• teachers

ISSUE 1 RUSSIA U.S. BILATERAL ON CYBERSECURITY CRITICAL TERMINOLOGY FOUNDATIONS APRIL 2011 The Russia U.S. Bilateral on Cybersecurity ґ Critical Terminology Foundations Issue 1 The principle editors of this document are: Karl Frederick Rauscher, EastWest Institute and Valery Yaschenko, Information Security Institute of Moscow State University. ... INFORMATION AND CYBER .. ... Scientific Adviser to the Director of the Lomonosov Moscow State University Institute of Information Security Issues. ...

Еще в разделе: (Показать все результаты (>11) - iisi.msu.ru/ )

• http://www.ipib.msu.ru/UserFiles/File/publications/mabit04.pdf

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>13) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out

... Main practical applications of X-rays lie in the important for the society fields of medical imaging, custom, transport inspection and security. Scientific applications besides of fundamental research include material sciences, biomicroscopy, and protein crystallography. ... The first are relatively cheap, robust, and compact but have low brightness and poorly controlled photon spectrum. ... So accelerator based X- ray sources are mainly still used for scientific applications and X-ray tubes ? ...

Еще в разделе: (Показать все результаты (>7) - miles.sinp.msu.ru/ )

• Laser-Electron X-Ray Source for Medical Applications | Проект ЭЛЛАРИ

hpc@cmc . Высокопроизводительные вычисления на ВМК МГУ . Blue Gene/P . Regatta . ... Серия Blue Gene в мире . ... Факультет вычислительной математики и кибернетики МГУ . ... parallel.ru . ... Parallel Computing . ... Некоммерческое программное обеспечение Intel : . ... Часть ссылок и описаний к ним любезно предоставлена администратором сайта кафедры АНИ факультета ВМК МГУ имени М. В. Ломоносова . Факультет ВМК МГУ . ... 2008 2013 Факультет ВМК МГУ имени М. В. Ломоносова . ...

Еще в разделе: (Показать все результаты (>2) - hpc.cs.msu.ru/ )

THE LABORATORY OF CHEMISTRY AND PHYSICS OF SENSOR AND SEMICONDUCTOR MATERIALS . ... The laboratory of chemistry and physics of sensor and semiconductor materials is the largest laboratory of Inorganic chemistry department , Lomonosov Moscow State University. The laboratory staff include 21 members and there are 25 students and postgraduate students of Chemistry Faculty , Physics Faculty and Faculty of Materials Science . ... semiconductor materials for sensors . ... Phone: +7(495) 939 54 71 . ...

Еще в разделе: (Показать все результаты (>19) - www.lssm.inorg.chem.msu.ru/ )

• The Laboratory of chemistry and physics of sensor and semiconductor materials |
• The Laboratory of chemistry and physics of sensor and

... Improvement of Java type compiler using in language independent remote process calls in KBase project. 09/2011 ґ present: Moscow State University, Dept. of Bioengineering and Bioinformatics (Russia) Scientific Research Java developer and lecturer Enhanced the CAMPS web resource (http://webclu.bio.wzw.tum.de/CAMPS2.0/) that enables multiple classification of transmembrane proteins. ... Developed web based UI for visualization of a graph of transmembrane protein families. ... Sutormin RA, Mironov AA. ...

Еще в разделе: (Показать все результаты (>10) - storage.bioinf.fbb.msu.ru/ )

• http://storage.bioinf.fbb.msu.ru/~roman/Sutormin_CV_aug2014.pdf
• http://storage.bioinf.fbb.msu.ru/~roman/jbcb_2006.pdf

... DESCRIPTION General Catalog of Variable Stars (GCVS database) . ... Kholopov P.N., Samus N.N., Durlevich O.V., Kazarovets E.V., Kireeva N.N., Tsvetkova T.M., 1990, General Catalogue of Variable Stars, 4rd ed., vol.IV, Nauka, Moscow. Kholopov P.N., Samus N.N., Durlevich O.V., Kazarovets E.V., Kireeva N.N., Tsvetkova T.M., 1992, General Catalogue of Variable Stars, 4rd ed., vol.IV, Bull. ... Kazarovets E.V., Durlevich O.V. Editor-in-Chief Samus N.N., 1998, New Catalogue of Suspected Variable Stars. ...

Еще в разделе: (Показать все результаты (>63) - sai.msu.ru/ )

• Конференции сайта АстрО

... T. A. Dolenko, S. A. Burikov, K. A. Laptinskiy, and O. E. Sarmanova, Improvement of the fidelity of molecular DNA computations: control of DNA duplex melting using Raman spectroscopy, Laser Physics, v. 26, No 2 Jessica M. Rosenholm, Igor I. Vlasov, Sergey A. Burikov, Tatiana A. Dolenko, and Olga A. Shenderova. ... A.O. Efitorov, S.A. Burikov, T.A. Dolenko, I.G. Persiantsev, S.A. Dolenko. ... 2016 Laboratory of laser spectroscopy of solutions of supramolecular compounds and nanostructures . ...

Еще в разделе: (Показать все результаты (>50) - rswater.phys.msu.ru/ )

• Лаборатория лазерной спектроскопии растворов супрамолекулярных соединений и
• Group of laser spectroscopy of solutions of supramolecular compounds and

Sergey A. Ayvazyan Methods of Econometrics Introduction Dear reader, You have a textbook in your hands on methods of econometrics, one of the three basic disciplines of higher economic learning, along with micro- and macroeconomics. In Russia, unfortunately, the status of econometrics was recognized belatedly: econometrics was introduced into the study programs of economic learning in several leading Russian higher educational institutions only since 1992. ...

Еще в разделе: (Показать все результаты (>17) - www.mse-msu.ru/ )

• http://www.mse-msu.ru/Nekipeliv_31012011.pdf
• http://www.mse-msu.ru/CV_Edoardo_Reviglio.pdf

. 2006-2007 Chemisty Department of Moscow State University web-design www.AdCode.ru . russian english .

Еще в разделе: (Показать все результаты (>2) - icho39.chem.msu.ru/ )

... Institute of Nuclear Physics, . ... I have been directly involved in theoretical and phenomenological analysis -- within the D? collaboration -- devoted to a search for single top quark production in the electroweak processes. ... 1] B. Abbott et al. ... D0 Collaboration], ``Inclusive jet production in p anti-p collisions,'' hep-ex/0011036. ... D0 Collaboration], ``Search for electroweak production of single top quarks in p anti-p collisions,'' hep-ex/0008024. ... Phys.Rev.Lett. ...

Еще в разделе: (Показать все результаты (>10) - top.sinp.msu.ru/ )

... About hotel . ... Rooms and prices . ... New laundry. In hotel there is a laundry for convenience of guests. ... Renewed website. The hotel т??69th Parallelт?? is glad to present its renewed website which now has an option of online booking! ... Use the form below you can book our rooms online and receive a guaranteed reservation. ... View all rooms . ... Reception: +7(8152) 253-700 . 7 (8152) 253-700 . ... Online booking . All rights Reserved 2009-13 Т? Hotel Т?69 ParallelТЛ . ...

254. http://library.biophys.msu.ru/matorin/3407.pdf

255. Rikho Nymmik

256. Институт Проблем Информационной Безопасности

257. Structure :: About Center for International Education :: CIE

258. SPAW Editor documentation

259. http://depni.sinp.msu.ru/~ivan_iv/sharpclass.html

260. Хостинг ВМК