... Electronic journal Issue 4. 10 september 2004 Vorontchuk, Cox III R.W. Developing a Competency-based Career Training and Professional Development Program for Latvia INTRODUCTION. ... With the support of a grant from the NISPAcee a team from the Latvian School of Public Administration, the University of Latvia and the University of Akron (Ohio, USA) prepared for the Chancellery of Latvia a proposal for the creation of a career-long professional development program for those in the civil service. ...

Еще в разделе: (Показать все результаты (>6) - e-journal.spa.msu.ru/ )

• http://e-journal.spa.msu.ru/uploads/vestnik/2004/vipusk_4._sentjabr_2004_g./paliulis_chlivickas.pdf
• http://e-journal.spa.msu.ru/uploads/vestnik/2004/vipusk_4._sentjabr_2004_g./nekipelov.pdf
• http://e-journal.spa.msu.ru/uploads/vestnik/2004/vipusk_4._sentjabr_2004_g./bonham_surin.pdf

THE RUSSIAN STYLE OF CIVIL PROCEDURE Dmitry Maleshin Reprinted from Emory International Law Review Volume 21, No. ... 26 See id. ... Another exceptional feature of the Russian civil procedure is the original status of judicial precedent as a source of Russian civil procedural law. ... 98 See OSCAR G. CHASE, LAW , CULTURE, AND RITUAL: DISPUTING SYSTEMS IN CROSS-CULTURAL CONTEXT 53-55 (2005); JAMES ET AL., supra note 6, at 309-10; THOMAS MAIN, GLOBAL ISSUES IN CIVIL PROCEDURE 5 (2006); Oscar G. Chase. ...

Еще в разделе: (Показать все результаты (>5) - www.law.msu.ru/ )

... Find the Brillouin zone for a 2D honeycomb lattice (lattice parameter d) and transform it into a hexagon. ... Compare the energies and the RMS charge radii electrons, in units of e). 1 2 (r )d3 x thus obtained ((x) is the total charge density of two 4. Find the density profile n(r) for an atom with the nucleus charge -Z e using the Thomas­ Fermi equation. ... Introducing the wavefunction (x) containing the low-energy degrees of freedom, find the effective wave equation for it. ...

Еще в разделе: (Показать все результаты (>7) - theorphys.phys.msu.ru/ )

... Курс обеспечивает интенсивный обзор тем по физиологии роста и развития растений, сосредотачиваясь на геномных, аналитических, вычислительных и других высоко-информативных современных подходах, необходимых для понимания биологии развития растений. Курс дает представление о генетических, молекулярных и биохимических механизмах, определяющих рост и развитие растений, включая механизмы спецификации клеток, клеточную организацию, морфогенез и формирование тканей и органов. ... Ритмы роста растений. ...

Еще в разделе: (Показать все результаты (>6) - plantphys.bio.msu.ru/ )

Вы посетили: activ_engl.html . ... История кафедры . ... Editor of the special issue of the journal Linear Algebra and its Applications devoted to Idempotent and Tropical Mathematics, 2010 . Editor of the journal Fundamental and Applied Mathematics . ... Linear Algebra and its Applications . Linear and Multilinear Algebra . ... Electronic Journal of Linear Algebra . ... staff/guterman/activ_engl.html.txt Последние изменения: 13.02.2013 11:26 (внешнее изменение) | ...

Еще в разделе: (Показать все результаты (>13) - halgebra.math.msu.su/ )

THE LABORATORY OF CHEMISTRY AND PHYSICS OF SENSOR AND SEMICONDUCTOR MATERIALS . ... New approaches to the synthesis of hybrid materials InP - organic stabilizer . ... To replace the membranes using standard samples CT InP, myristic acid, stabilized, and samples heterostructures InP / ZnSe with two monolayers Accrued zinc selenide and also stabilized myristic acid. ... 2008-2014 The Laboratory of chemistry and physics of sensor and semiconductor materials. ...

Еще в разделе: (Показать все результаты (>13) - www.lssm.inorg.chem.msu.ru/ )

• The Laboratory of chemistry and physics of sensor and

... Информационный портал о карьере и работе для студентов и выпускников технических и естественнонаучных специальностей . ... Ярмарка вакансий и стажировок для студентов и выпускников вузов . Новости науки и техники События . ... Подписаться на новости . Вакансии . ... Ярмарки вакансий и выставки . ... Ярмарка вакансий "Формула карьеры" . ... Если вы хотите регулярно получать информацию о новых вакансиях, наших мероприятиях и новостях сайта, оставьте, пожалуйста, свой адрес. ...

Еще в разделе: (Показать все результаты (>58) - www.physcareer.ru/ )

• Summer2008 Internships for Students / Стажировки / Physcareer.ru
• Receptionist (Секретарь на ресепшн) / Вакансии / Physcareer.ru
• Business Analyst/ Senior Business analyst at Business Technology department /

Regular Maps and Their Groups H. R. Brahana American Journal of Mathematics, Vol. ... In the one case the number of regions of the map is equal to twice the order of the group and in the other the number of regions is equal to the, order of the group divided by the number of sides of a region. ... The Group of a Regular Map. ... Noting that there exists no group of order 40 and degree 8, we have the result that there exists no regular map of ten 4-sided regions on - a surface of genus two. ...

Еще в разделе: (Показать все результаты (>40) - dfgm.math.msu.su/ )

• http://dfgm.math.msu.su/files/papers-sym/0503389v1.pdf
• http://dfgm.math.msu.su/files/papers-sym/conder.pdf

... Anti thrombin DNA aptamers were immobilized on silica microspheres, placed inside microwells on the distal tip on an imaging optical fiber, coupled to a modified epifluorescence microscope through its proximal tip. ... It should be mentioned that since thrombin is not a DNA binding protein, the possibility to elicit thrombin­aptamer complexes clearly demonstrates the power of SELEX technology. ... Specificity of aptamer coated beads for F thrombin binding was assessed with bovine serum albumin. ...

Еще в разделе: (Показать все результаты (>5) - rnp-group.genebee.msu.ru/ )

• http://rnp-group.genebee.msu.su/pdfs/MolBio6_00KopylovLO.pdf

... The detectors used in the setup had efficiency three orders of magnitude better than ones used before. ... As a result, effect of nonlocal influences of several largescale processes related with the weather changes, the geomagnetic variations, the ionospheric and solar activity have reliable been detected. ... йи з ед гв б 7 (2) (3) (4) All known local factors influencing on : temperature, pressure, chemism, illumination, electric field etc. must be excluded or stabilised. ...

Еще в разделе: (Показать все результаты (>13) - temporology.bio.msu.ru/ )

• http://temporology.bio.msu.ru/EREPORTS/korotaev_geophysical.pdf

... Написать комментарий . ... Астрокартинка дня: "Загадка в гамма-лучах" . ... На фото, представленном на сайте " Astronomy Picture of the Day ", изображение неба в гамма-лучах , полученное гамма-детектором "Egret" с борта обсерватории " Комптон " еще в 90-е годы. ... Да, в этих лучах открыто много загадочных явлений и самое поразительное - это гамма-всплески . ... Еще в 70-е годы наши астрофизики накопили самый обширный материал по гамма-всплескам. ...

Еще в разделе: (Показать все результаты (>209) - www.nature.web.ru/ )

• Астрономической картинке дня шесть лет!
• Научная Сеть
• Доклиническая диагностика семейной гиперхолестеринемии с помощью анализа ДНК

MSU . Science Park . ... 2-4 June 2014, Moscow hosted the Third International Summit of technology parks and business incubators "Technoparks as new drivers of national economic development." ... To do this for three days at the III Summit held an educational seminar "Managing effective business incubators and technology parks" with American colleagues - Heads of existing industrial parks and technology transfer centers. ... JSC MSU Science Park. ...

Еще в разделе: (Показать все результаты (>4) - www.sciencepark.ru/ )

... We will dwell on linguistic aspects and Lexical Resources of POLITEXT branch having in mind some intermediate semantic representation of a whole text as the basis for differentiated Information Extraction. It is personal data (in the social sphere) recognition in texts that we focus on, see (Leontyeva et al. ... As the main instrument of semantic analysis of coherent texts this dictionary bears the important information on how to build BTF-units starting from lexemes of SemDict entries. ...

Еще в разделе: (Показать все результаты (>4) - leontyeva.srcc.msu.ru/ )

... The Informativeness of Coherence Analysis in EEG Studies A. P. Kulaichev UDC 612.821.6 Translated from Zhurnal Vysshei Nervnoi Deyatel'nosti imeni I. P. Pavlova, Vol. ... KEY WORDS: coherence, spectral analysis, EEG non-stationarity, amplitude modulation. ... In particular, the two fundamental differences between EEG signals and most other physical signals are not considered: a) fundamental non-stationarity; b) amplitude modulation at all frequency ranges. ... Coherence in technical addenda. ...

Еще в разделе: (Показать все результаты (>11) - www.protein.bio.msu.ru/ )

Contents Curricula, and Programs. Mathematical Analysis. (The Program of Mathematical Physics Department).............................................. Algebra and Analytical Geometry.(The program of (General "Mathematics" Department)................................ Computer and Programming. (The program of Algorithmic Languages Department).................................... The practical work on Computers.( Department of Algorithmic. Languages)............................................... Discrete

Еще в разделе: (Показать все результаты (>2) - mph.cmc.msu.ru/ )

30 TH I NT E R N AT I ON AL C OSMIC R AY C O N F ER EN C E Search for global asymmetry of UHECR arrival directions with the TUS space detector P. K LI M OV 1 ,O. K AL ASHE V 2 , B . ... Introduction Space-based ultra-high-energy cosmic-ray detectors such as TUS or JEM/EUSO are best suited for searches of the global anisotropies in the distribution of arrival directions of cosmic-ray particles because they provide full-sky coverage with a single experiment. ... Phys. 12, 25 (1999). ... Phys. Lett. ...

Еще в разделе: (Показать все результаты (>3) - cosrad.sinp.msu.ru/ )

... Phone: (007) 095-9395197; fax: (007) 095-9395888; e-mail: e@lav01.sinp.msu.ru . ... The term of training - 1-2 years. ... Physics of quark-gluon mesons spectroscopy? ... Scientific chief - Ludmila Ivanovna Sarycheva, professor of the Chair of Cosmic Rays and Physics of Cosmos and leader of Laboratory of Hadron Interactions of SINP MSU senior science researcher, PhD. ... Simultaneously the problem of the solar cosmic ray flare energetic electron sources in the interplanetary space will be studied. ...

Еще в разделе: (Показать все результаты (>27) - foroff.phys.msu.ru/ )

• Key research directions
• Admission Regulation
• Papers of our group

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>12) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out

... Veselovsky, V.A., Djanumov D.A. The use of biophysical methods in the study of adaptive reactions of plants, in connection with the problem of resistance. ... Kulaeva, O.N., Mikulovich T.P., Veselova, T.V., Veselovsky, V.A., Kukina, I.M., Klyueva N.Yu. ... Veselovsky, V.A., Veselova T.V . ... Nauka, Moscow (in Russian).1990. 200 p. Veselova T.V., Veselovsky V.A., Chernavsky D.S. Stress of Plant: A Biophysical Approach. ... Veselova T.V., Veselovsky V.A. Photosynthesis and stress of plant cells. ...

Еще в разделе: (Показать все результаты (>5) - biophys.msu.ru/ )

• One of the informative characteristics of the reverse electron transport in the
• CURRICULUM VITAE

Cosmic Research, Vol. 42, No. 5, 2004, pp. 489­534. Translated from Kosmicheskie Issledovaniya, Vol. 42, No. 5, 2004, pp. 509­554. Original Russian Text Copyright © 2004 by Panasyuk, Kuznetsov, Lazutin, Avdyushi, Alexeev, Ammosov, Antonova, Baishev, Belenkaya, Beletsky, Belov, Benghin, Bobrovnikov, Bondarenko, Boyarchuk, Veselovsky, Vyushkova, Gavrilieva, Gaidash, Ginzburg, Denisov, Dmitriev, Zherebtsov, Zeleny, Ivanov-Kholodny, Kalegaev, Kanonidi, Kleimenova, Kozyreva, Kolomiitsev, Krasheninnikov,

Еще в разделе: (Показать все результаты (>2) - solarwind.cosmos.ru/ )

• http://www.kosmofizika.ru/buri/vesel2.pdf