Draft Dr. Paul Twomey President and Chief Executive Officer Internet Corporation for Assigned Names and Numbers (ICANN) Speech to Third International Forum Partnership Among State, Business Community and Civil Society in Ensuring Information Security Garmisch-Partenkirchen, Germany Monday, 20 April 2009 Dear Vladislav Petrovich, Dear Alexei Anatolievich, Distinguished guests, Ladies and Gentlemen. ... ICANN itself is evolving, mirroring the changing nature of the global Internet community. ...
[
Текст
]
Ссылки http://www.iisi.msu.ru/UserFiles/File/bayern2009/twomey.doc -- 44.0 Кб -- 02.04.2012
[
Текст
]
Ссылки http://www.ipib.msu.ru/UserFiles/File/bayern2009/twomey.doc -- 44.0 Кб -- 02.04.2012
[
Текст
]
Ссылки http://iisi.msu.ru/UserFiles/File/bayern2009/twomey.doc -- 44.0 Кб -- 02.04.2012 Похожие документы
... A p P EC Astropar ticle Physics for Europe · Cosmic rays: A large array for the detection of charged cosmic rays ( Auger North) · Gamma rays: A large array of Cherenkov Telescopes for detection of cosmic high energy gamma-rays ( CTA ) · High energy neutrinos: A cubic kilometre-scale neutrino telescope in the Mediterranean (KM3NeT) · Dark matter search: Ton-scale detectors ... A p P EC Astropar ticle Physics for Europe · Cosmic rays: AMS detector launched. ...
JOURNAL OF APPLIED PHYSICS VOLUME 86, NUMBER 6 15 SEPTEMBER 1999 The rate of radiative recombination in the nitride semiconductors and alloys Alexey Dmitrieva) and Alexander Oruzheinikov Department of Low Temperature Physics, Faculty of Physics, M. V. Lomonosov Moscow State University, Moscow, 119899, Russia Received 7 January 1999; accepted for publication 27 May 1999 The radiative recombination rates of free carriers and lifetimes of ... Phys., Vol. ... We will see in the Sec. ...
Langmuir 2005, 21, 8243-8249 8243 The "Wimple": Rippled Deformation of a Fluid Drop Caused by Hydrodynamic and Surface Forces during Thin Film Drainage Lucy Y. Clasohm,, Jason N. Connor,,| ... In Final Form: June 16, 2005 It is well-known that hydrodynamic pressures in a thin draining liquid film can cause inversion of the curvature of a drop or bubble surface as it approaches another surface, creating a so-called "dimple". ... WimplesRippled Deformation of a Fluid Drop Langmuir, Vol. ...
Научно-образовательный центр Геномного секвенирования МГУ . ... Sep 11, 2014, 9:17 AM . Yegor Bazykin attached NGS_supported_list.pdf to Результаты конкурса NGS-проектов . ... Yegor Bazykin deleted attachment NGS_supported_list.pdf from Результаты конкурса NGS-проектов . ... Yegor Bazykin edited Конкурс NGS-проектов . ... Yegor Bazykin created Результаты конкурса NGS-проектов . Jul 5, 2014, 2:53 AM . Yegor Bazykin updated polozhenie.pdf . ... Recent Site Activity | ...
Annu. ... Key Words stellar energy production, Nobel Prize, supernova, binary pairs s Abstract Astrophysics has been an important part of my personal and scientific life three times. ... Gamov suggested to one of his graduate students, Charles Critchfield, that he actually calculate the proton-proton reaction. ... In stars, the proton-proton reaction is usually followed by a chain of reactions with the end result of producing 4He. ... In 1938, they suggested energy production in stars. ...
Core information (Nucleus, Levels, Gamma transition, Decays, Data type) . ... any adopted (levels and gammas only) experimental . ... Query parameters: . Select for output . ... Levels (E, JPI, T1/2, etc.) ... Energy (keV) . ... Y D H M S MS US NS PS FS AS EV KEV MEV or Stable . ... Energy of the ?-ray (keV) . Relative photon intensity . ... Energy parameters of nucleus (B , Alpha energy, N, P separation energy) . ... Neutron separation energy (keV) . Proton separation energy (keV) . ...
THE RUSSIAN STYLE OF CIVIL PROCEDURE Dmitry Maleshin Reprinted from Emory International Law Review Volume 21, No. ... 26 See id. ... Another exceptional feature of the Russian civil procedure is the original status of judicial precedent as a source of Russian civil procedural law. ... 98 See OSCAR G. CHASE, LAW , CULTURE, AND RITUAL: DISPUTING SYSTEMS IN CROSS-CULTURAL CONTEXT 53-55 (2005); JAMES ET AL., supra note 6, at 309-10; THOMAS MAIN, GLOBAL ISSUES IN CIVIL PROCEDURE 5 (2006); Oscar G. Chase. ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
Mechmath admission for internetional students . Specialist degree . ... Specialist variants . Master degree . ... Master variants . ... Scientific Research Training . ... We?ll tell you what you need to know about the Festival of Science. ... What is the Festival of Science, and why is it so attractive to all who have participated in it?both children and adults?that they look forward eagerly to each new Festival? ... 2016 Mechmath admission for internetional students ...
Biophysics, Vol. ... CELL BIOPHYSICS Kinetic Model of Primary Photosynthetic Processes in Chloroplasts. Description of the Fast Phase of Chlorophyll Fluorescence Induction under Different Light Intensities G. V. Lebedeva-, N. E. Belyaeva", O. V. Demin-, G. Yu. ... In the framework of the model, we present a description of the fast phase of chlorophyll fluorescence induction as dependent on the kinetics of the main primary steps of photosynthesis in a broad range of illumination intensity. ...
Exchanges Internships abroad for MSU students . Home . ... Exchanges . ... Exchanges with Moscow University . ... Internships abroad for MSU students . Every student of MSU has an opportunity to participate in academic exchange programs, in case they fail to find a necessary course at home University. ... Lomonosov Moscow State University . International Relations Office 2007-2008 ...
... Елена Фоменко (2 курс). ... Руководитель В. И. Буник, отдел биокинетики НИИ ФХБ им. А.Н.Белозерского МГУ. ... Руководитель А.Г. Евстафьева, отдел химии и биохимии нуклеопротеидов НИИ ФХБ им. А.Н. Белозерского МГУ. ... Руководитель Н.В. Чичкова, лаборатория молекулярной биологии гена отдела химии и биохимии нуклеопротеидов НИИ ФХБ им. А.Н. Белозерского МГУ. ... Руководитель А.Г. Евстафьева, лаборатория молекулярной биологии гена отдела химии и биохимии нуклеопротеидов НИИ ФХБ им. А.Н. Белозерского...
... Nonlinearoptical magnetic Kerr effect in MPC with a half-wavelength-thick Bi-substituted yttriumirongarnet layer sandwiched between two dielectric Bragg reflectors is studied in transversal, longitudinal, and polar configurations of the dc magnetic field application when the fundamental radiation is in the resonance with the allowed microcavity mode located in the photonic band gap. ... The SH intensity is enhanced as the fundamental wave is in resonance with the microcavity mode. ... Phys. Lett. ...
[
Текст
]
Ссылки http://shg.phys.msu.ru/ruscon/articles/pdf/04_LasPhys_14_MPC.pdf -- 103.2 Кб -- 12.03.2008 Похожие документы
Optimized MASS device for synchronous measurements with Paranal DIMM. ... System 1.2.2 Fabry lens . ... 3.2 Device alignments at the telescop 3.2.1 Fabry lens p osition . ... Optical layout of MASS device in ZY plane . Optical layout of the MASS device in ZX plane MASS segmentator . ... Other values are explained in text. working entrance pupils for the MASS devices can b e defined in reverse light path as the images of these pupil stops pro duced by the Fabry lens + telescop e optical system. ...
Conference on 'Reflections on the atomic nucleus', 28.06.2015, Liverpool, UK. This meeting, see http://ns.ph.liv.ac.uk/Reflections2015 , will touch upon a few sub-topics of current interest in nuclear structure physics including aspects of nuclear collectivity, strengths, shell evolution and super-heavy elements as well as sessions devoted to nuclear astrophysics, fundamental physics and new experimental probes. ... The conference fee is ?100. ...
... 000, 113 (2010) Printed 21 September 2011 A (MN L TEX style file v2.2) A universal ultraviolet-optical colourcolourmagnitude relation of galaxies I1gor V. Chilingarian1,2, and Ivan Yu. ... Received 2011 Sep 15; in original form 2011 Feb 6 ABSTRACT The bimodal galaxy distribution in the optical colourmagnitude diagram (CMD) comprises a narrow "red sequence" populated mostly by early-type galaxies and a broad "blue cloud" dominated by star-forming systems. ...
... Subject to the MOIP Charter both natural and legal persons may become the members of the Society upon paying admission fees and acknowledging the Charter and program documents. ... Persons may be elected as the Society?s full and corresponding members on a show of hands at the Society?s Council (Presidium) meeting if nominated by a section and recommended by at least two full Society?s members. ... The Society?s full members have the following rights: . ... 2015 Moscow Society of Naturalists . ...
... B.V. Somov . head of the department . ... room 80 . ... senior research felow . ... research felow . ... research fellow . ... Our department performes the following most perspective studies: . Special analytical and numerical experimental investigations of the solar plasma involved in the magnetic reconnection process at the Sun. ... Head of the seminar: Prof. B.V. Somov. ... 27 September 2013 The Solar Physics Department was visited by journalists of the leading Russian TV channel "Vesti-1". ...
Head of sector, acting head of the Computational Geophysics Division of the M.V. Keldysh Institute for Applied Mathematics, RAS. ... Finished the Electrodynamics and Quantum Theory Department of Faculty of Physics, MSU in 1962. ... Ill-posed problems, stochastic processes, theory of approximation. Mechanics and physics of multi-phase media, phenomena in porous media, difference schemes for some classes of mathematical physics problems (filtration, elasticity theory). ...