... Область ПЛИС-компьютеров является достаточно молодой и бурно развивающейся в настоящее время. ... CLB (Configurable Logic Blocks) - программируемый логический блок, часть FPGA-устройства, предназначенная для программирования некоторой функции или ее части. ... FPSC (Field Programmable System Chip) - устройство, представляющее собой объединение на одном кристалле FPGA и встроенного ASIC -ядра. ... PLA (Programmable Logic Array) - программируемые логические устройства наподобие ППЗУ . ...
. NON-STATIONARY OPERATION OF THE FAST-FLOW LASERS . AND NEW POSSIBILITIES OF CONTROLLING THE LASER OUTPUT CHARACTERISTICS . A.V. Mushenkov, A.Yu.Loskutov, A.I.Odintsov, A.I.Fedoseev and V.F.Sharkov . Physics department of M.V.Lomonosov Moscow State University, 119899, Vorob'evy gory, Moscow, Russia . Abstract . The dynamics of the lasing of the fast crossflow gas laser with the inhomogeneous steady state pumping in the unstable resonator by means of numerical modeling is investigated. Depending on the
... немецкий химик, член Берлинской Академии наук . Цирконий (лат. ... Известно пять природных изотопов циркония: 90 Zr (51,46%), 91 Zr (11,23%), 92 Zr (17,11%) 94 Zr (17,4%), 96 Zr (2,8%). В 1789 году немецкий химик М. Г. Клапрот в результате анализа минерала циркона выделил двуокись циркония Порошкообразный цирконий впервые был получен в 1824 году И. Берцелиусом, а пластичный - в 1925 году нидерландскими учеными А. ван Аркелом и И. де Буром при термической диссоциации иодидов циркония. ...
... PhD thesis title: Gauge dependence of effective action in quantum gravity. ... Research fields of interest . Combustion: nonlinear development of the Darrieus-Landau instability of premixed flames, nonlinear flame stabilization and steady flame propagation, asymptotic methods, small gas expansion limit, non-perturbative description of curved flames, flame propagation in gravitational field, propagation of diffusion flames in counterflows. ... Gauge-independent effective gauge fields. ...
... 8 February , 2014 SAI seminar (Ryde et al 2010) 5 Thermal emission from GRB jet progenitor observer photon jet Photosphere (=1) · · · · Photons are not produced at the photosphere We have to calculate radiative transfer We need to know where the photons are produced We construct the expression for effective optical depth in relativistic flow considering random walk process in relativistic flow SAI seminar 6 8 ... 8 February, 2014 SAI seminar 28 ...
[
Текст
]
Ссылки http://master.sai.msu.ru/media/presentations/2014/20140208_Shibata.pdf -- 1131.7 Кб -- 07.02.2014 Похожие документы
... The 2016 Beacon Satellite Symposium will be held at the International Centre for Theoretical Physics (ICTP) at Trieste, Italy, from 27 June to 1 July 2016. ... Абстракты - 15/02/2016 . Подробнее на сайте: http://t-ict4d.ictp.it/beacon2016 . Конференция "Распространение радиоволн" имеет более чем 40-летнюю историю и проводится раз в два-три года в центральных городах России. 15 декабря 2015 г. - начало регистрации участников и представления текстов докладов . ... D.Физика атмосферы . ...
A full system of equilibrium differential equations for the finite number of suspension lines (n = 28) of square parachute is derived. ... One can determine the shapes of inflated canopy radial cross-sections, stress distribution of radial ribbons on the canopy surface and fabric stress between them, drag coefficients for various line lengths and air-permeability by means of computer simulation. ... Initially, this problem was solved assuming D p = const over total canopy of square parachute. ...
... 1998 1 : Defended the Doctorate Degree Thesis on "Models of Cosmic Ray Particle Fluxes (Development and Applications)". ... Space Weather . ... Nymmik R.A., Radiation Environment Induced by Cosmic Ray Particle Fluxes in International Space Station Orbit According to Recent Solar and Galactic Cosmic Ray Models, Adv. ... Nymmik R.A., Radiation Environment Induced by Cosmic Ray Particle Fluxes in International Space Station Orbit According to Recent Solar and Galactic Cosmic Ray Models, Adv.Space Res. ...
To use Microsoft Outlook Web access, browser settings must allow scripts to run. ... If your browser does not support scripts, you can download Microsoft Internet Explorer for access to Outlook Web Access. ... Select this option if you use Outlook Web Access on a public computer. ... This is a private computer . ... Use Outlook Web Access Light . ... Type the address for Outlook Web Access into the field, click Allow, and then click OK to save your changes. Connected to Microsoft Exchange . ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... О журнале . ... Условия публикации . ... 2007 Г., ?1, ВЫП.5 . 2006 Г., ?3, ВЫП. ... 2006 г., ?1, вып. ... Электронный научный журнал ?ДОКЛАДЫ ПО ЭКОЛОГИЧЕСКОМУ ПОЧВОВЕДЕНИЮ? ... INTERACTIVE JOURNAL OF ECOLOGICAL SOIL SCIENCE?) Образован в 2006 году для онлайновой публикации работ по широкому спектру вопросов, связанных с экологическим почвоведением. ... Институт экологического почвоведения МГУ . ... Журнал образован взамен ранее учрежденного журнала ?Доклады по почвоведению? ...
О кафедре . ... Курс общей физики . ... Специальные курсы для студентов кафедры . ... Молекулярная электроника . ... Добро пожаловать на сайт кафедры! Всего несколько лет назад нанотехнология появилась в поле зрения всеобщего внимания, в основном, как символ и содержание очередного этапа миниатюризации электроники. ... Кафедра общей физики и молекулярной электроники уже более пятнадцати лет занимается исследованиями в области нанотехнологий. ... 2016 Кафедра Общей Физики и Молекулярной Электроники ...
Discover the cosmos! ... 2000 December 29 . The Dark Horsehead Nebula . ... Image Processed by Al Kelly . Explanation: While drifting through the cosmos this magnificent interstellar dust cloud, sculpted by stellar winds and radiation, has chanced to assume a recognizable shape. Fittingly named The Horsehead Nebula it is embedded in the immense complex of star forming gas and dust surrounding the Orion Nebula some 1,500 light-years distant. ... About APOD | ...
... Porokhov, N., Kalabukhov, A., Chukharkin, M., Maresov, A., Khrykin, D., Klenov, N., and Snigirev, O. The physical basis of the fabrication of the third generation of high-temperature superconducting wires on quartz substrates.љ ... DOI љ] . ... Journal of Superconductivity and Novel Magnetism љ(2014). ... Сhukharkin, M., Kalaboukhov, A., Schnaiderman, J., Oisjoen, F., Jonsson, M., Xie, M., Snigirev, O., Winkler, D. Novel hts dc squid solutions for nmr applications. ... Superconducting electronics . ...
Federation of European Societies on Trace Elements and Minerals PRELIMINARY SCIENTIFIC PROGRAM 09.06.2010 SESSION 1. Trace element and mineral analysis of environmental and biological samples: bulk determination, speciation and quality control. ... 10.06.2010 SESSION 2. ... SYMPOSIUM ORGANIZATION Venue The 4th International Symposium on Trace Elements and Minerals in Medicine and * Biology will take place in the Hotel "Okhtinskaya" (4, Bolsheokhtinsky prospect, 195027 St.Petersburg, Russia). ...
[
Текст
]
Ссылки http://www.fbm.msu.ru/sci/sno/conf/russia/IV%20FESTEM%20Symposium.pdf -- 315.9 Кб -- 26.12.2009 Похожие документы
... 11:00-11:30 Break 11:30-12:00 Lecture 3 Prof . Heinz Oberhammer , Institute of Physical and Theoretical Chemistry , University of Tubingen, Germany Structures and Conformations of Disilacyclohexanes 12:00-12:30 Lecture 4 Prof . Ingvar Arnason , University of Iceland, Iceland Energetics and Potentional Energy Surfaces of Disilacyclohexanes 12:30-13:00 Lecture 5 Prof . Igor Godunov, Chemistry Department , MSU , ...
THE LABORATORY OF CHEMISTRY AND PHYSICS OF SENSOR AND SEMICONDUCTOR MATERIALS . ... Reactivity thermoelectric clathrate compounds in interaction with components of the air . The project aims to address the fundamental problems of solid state chemistry - revealing the fundamental regularities of the reactivity of crystalline phases in reactions with air components and processes of formation of oxide layers (coatings) for new materials. ...
... Soc. 376, 10331046 (2007) doi:10.1111/j.1365-2966.2007.11549.x Kinematics and stellar populations of the dwarf elliptical galaxy IC 3653 I. V. Chilingarian,1 1 2 ,2,3 P. Prugniel, 2,4 O. K. Sil'chenko1 and V. L. Afanasiev 5 Sternberg Astronomical Institute of the Moscow State University, Universitetsky pr. ... Fitting the spectra with synthetic single stellar populations (SSP), we found an SSPequivalent age of 5 Gyr and nearly solar metallicity [Fe/H] =-0.06 dex. ... 2007 The Authors. ...