... Assume that gas is a thermodynamic system in the state of local equilibrium, that is, it is satisfied the relation [2] [pic] (1) There [pic],[pic] and [pic] are the temperature, the pressure and the gas volume, [pic], [pic] are entropy and internal energy per unit volume. ... Let us consider the first-degree form [pic]. ... Since the evolutionary relation is not identical, from this relation one cannot get the state differential [pic] that may point to the equilibrium state of the material system. ...

Еще в разделе: (Показать все результаты (>19) - hit-conf.imec.msu.ru/ )

• http://hit-conf.imec.msu.ru/books/NeZaTeGiUs_2010.pdf
• http://hit-conf.imec.msu.ru/2006/CD/Palymskiy2.doc

Ковалевский В.Л., Савинов В.П. Экспериментальное обоснование модели физического механизма емкостного ВЧ - разряда низкого давления // Физика плазмы.Т.20.?3 (1994), с.322 - 334. Рябый В.А., Савинов В.П., Спорыхин А.А., Якунин В.Г. Электрические пробои МОП - структур - важнейший фактор плазменной деградации микроэлектронных чипов // Микроэлектроника.Т.25.? ...

Еще в разделе: (Показать все результаты (>6) - physelec.phys.msu.ru/ )

Cosmic Research, Vol. 42, No. 5, 2004, pp. 435­488. Translated from Kosmicheskie Issledovaniya, Vol. 42, No. 5, 2004, pp. 453­508. Original Russian Text Copyright © 2004 by Veselovsky, Panasyuk, Avdyushin, Bazilevskaya, Belov, Bogachev, Bogod, Bogomolov, Bothmer, Boyarchuk, Vashenyuk, Vlasov, Gnezdilov, Gorgutsa, Grechnev, Denisov, Dmitriev, Dryer, Yermolaev, Eroshenko, Zherebtsov, Zhitnik, Zhukov, Zastenker, Zelenyi, Zeldovich, Ivanov-Kholodnyi, Ignat'ev, Ishkov, Kolomiytsev, Krasheninnikov, Kudela,

Еще в разделе: (Показать все результаты (>2) - solarwind.cosmos.ru/ )

• http://www.kosmofizika.ru/buri/pansyketal.pdf

ISSN 0026-2617, Microbiology, 2008, Vol. ... Key words: late stationary phase, secondary growth, Pseudomonas aeruginosa, S and M dissociants, population structure of the culture. ... Growth dynamics and population composition of a mixed culture of P. aeruginosa S and M dissociants in the variant of autolysis in the late stationary phase: optical density, OD з 100 (1); ratio of the M dissociant in the population, % (2); pH (3); and content of reducing sugars, mg % (as glucose) (4). ...

Еще в разделе: (Показать все результаты (>10) - dis.bio.msu.ru/ )

• http://dis.bio.msu.ru/States/Fursova_Mil'ko_2006_en.pdf

Special courses for the students of Physics Faculty, specialized at the Department. ... 32 hours, 6-th term . ... A review of characteristic ferroelectric and magnetic materials is given. ... The anomalies of physical properties in the phase transition in accordance with the crystal symmetry. ... Solid state physics . ... It is assumed that student will get knowledge about magnetic properties of such systems as molecular, clusters, nano-particles, surfaces, ultra thin films, mono- and multilayers. ...

Еще в разделе: (Показать все результаты (>10) - ferro.phys.msu.ru/ )

4 SPIN. ... 0 1 Hello, world! ( ) ";" , active proctype main() { printf("Hello, world!\n") } ­ , >spin hello.pml Hello, world! 1 process created Hello, world! ... mtype = { P, C }; mtype turn = P; active proctype producer() { do :: ( turn == P) - printf( Produce\n ); turn = C od } active proctype consumer() { do :: ( turn == C) - printf( Consume\n ); turn = P od } ( 1) ­ 0, (op on sequence) (guard) ­ mtype = { P, C }; mtype turn = P; active proctype producer() { do :: ( ...

Еще в разделе: (Показать все результаты (>4) - savenkov.lvk.cs.msu.su/ )

... О магистерской программе . Преимущества программы . ... On-line консультант . ... Для студентов факультета ВМиК МГУ им. М.В.Ломоносова будут читаться курсы по управлению бизнес-процессами. ... Андрей Коптелов из Software AG будет читать курс Анализ бизнес-процессов Process Intelligence , а его коллега Олег Бейлензон курс Проектирование и автоматизация бизнес-процессов . ... В прошедшем семестре специалисты из Software AG уже прочитали пробный спецкурс Контроллинг и автоматизация бизнес-процессов . ...

Еще в разделе: (Показать все результаты (>7) - erp.cmc.msu.ru/ )

... Cultural Mediation of National History and Identity . ... Second International Conference in Tampere , Finland . ... This sense of national identity, of history and possible futures, is communicated by cultural and institutional forces and integrated, individually and collectively, into our sense of a common shared nationhood. ... Through a semiological analysis of television texts, it is demonstrated how, by a re-interpretation of Russian history, new cultural and national identities are...

Еще в разделе: (Показать все результаты (>7) - psyberlink.flogiston.ru/ )

... IM2, c (2222430 nt) initn: 382 init1: 382 opt : 402 Z-score: 427.8 bits : 96.2 E(75): 3.7e-20 banded Smith-Waterman score: 402; 64.1% identity (64.1% similar) in 234 nt overlap (68- 300 :1090800-1091033) 40 50 60 70 80 90 NC_000 TAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTC-CGT :: : ::: :::: :: :: :: :: AE0094 AAGAGCCCGGCTTTTGCCCGGTCTAAAACGCCGGGCGAATAAGCGGGGGGCAAGTCTGGT 1090770 1090780 1090790 1090800 1090810 1090820 100 110 120 130 140 150 ...

Еще в разделе: (Показать все результаты (>7) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out

International Maize and Wheat Improvement Center No. ... AFRICA "Maize production is likely to suffer the most due to climate change compared to other crops in Southern Africa," said CIMMYT physiologist Jill Cairns, who presented on CIMMYT work under the CGIAR Research Program on Climate Change, Agriculture and Food Security (CCAFS) at the FAO Agriculture Coordination & Information Forum in Harare, Zimbabwe, on 25 July 2013. ... Policy makers in the seed value chain must be engaged as well. ... 2013. ...

Еще в разделе: (Показать все результаты (>11) - ecfs.msu.ru/ )

• Online Consultation on Network and Partnerships in the area of Food Security |
• Topic 1: Building the Eurasian Food Security Network / Создание Евразийской

... 000, 1­13 (2010) Printed 21 September 2011 A (MN L TEX style file v2.2) A universal ultraviolet-optical colour­colour­magnitude relation of galaxies I1gor V. Chilingarian1,2, and Ivan Yu. ... Received 2011 Sep 15; in original form 2011 Feb 6 ABSTRACT The bimodal galaxy distribution in the optical colour­magnitude diagram (CMD) comprises a narrow "red sequence" populated mostly by early-type galaxies and a broad "blue cloud" dominated by star-forming systems. ...

Еще в разделе: (Показать все результаты (>4) - kcor.sai.msu.ru/ )

• http://kcor.sai.msu.ru/arXiv1002.2360.pdf

Available on CMS information server CMS NOTE 2000/065 The Compact Muon Solenoid Experiment Mailing address: CMS CERN, CH­1211 GENEVA 23, Switzerland CMS Note ``SingleTop'' ­ an event generator for the single top quark production at the LHC. ... But this process has sufficiently different signature which is similar to the top quark pair production signature. ... The events for the two main processes of the single top quark production at the LHC are available in the CMS processes data base PEVLIB [14]. ...

Еще в разделе: (Показать все результаты (>6) - top.sinp.msu.ru/ )

• http://top.sinp.msu.ru/lev/d0note_3612.ps
• Фоновые процессы.

... About CIE MSU . Academic Programmes . ... Student's Life . ... Vestnik CIE (in Russian) . ... About Moscow University . ... Pre-University Programme . Pre-University Training prepares students to enter university degree programmes (undergraduate or graduate) in the Russian Federation. The programme profile embraces: . ... Our Pre-University Programmes are intended for highly motivated students who seek to enter university degree programmes (undergraduate or graduate) in Russian Federation. ...

Еще в разделе: (Показать все результаты (>13) - www.cie.ru/ )

• Overview :: About Center For International Education :: CIE
• Russian as a Foreign Language Testing :: Academic Programmes :: CIE

... О факультете . ... Heng Zhang, Lei Li, Martin M?ller, Xiaomin Zhu, Jaime J. Hernandez Rueda, Martin Rosenthal, and Dimitri A. Ivanov*// From Channel-Forming Ionic Liquid Crystals Exhibiting Humidity-Induced Phase Transitions to Nanostructured Ion-Conducting Polymer Membranes "// Advanced Materials 25 (2013) 3543-3548. ... МГУ имени М.В.Ломоносова; авторы Герасин В.А., Иванов Д.А., Антипов Е.М. , Князев Я.В., Антипова Л.А., Гусева М.А. Список статей, опубликованных членами трудового коллектива . ...

Еще в разделе: (Показать все результаты (>8) - www.test.physchem.msu.ru/ )

... Елена Фоменко (2 курс). ... Руководитель В. И. Буник, отдел биокинетики НИИ ФХБ им. А.Н.Белозерского МГУ. ... Руководитель А.Г. Евстафьева, отдел химии и биохимии нуклеопротеидов НИИ ФХБ им. А.Н. Белозерского МГУ. ... Руководитель Н.В. Чичкова, лаборатория молекулярной биологии гена отдела химии и биохимии нуклеопротеидов НИИ ФХБ им. А.Н. Белозерского МГУ. ... Руководитель А.Г. Евстафьева, лаборатория молекулярной биологии гена отдела химии и биохимии нуклеопротеидов НИИ ФХБ им. А.Н. Белозерского...

Еще в разделе: (Показать все результаты (>2) - www.fbb.msu.ru/ )

Historical sources . In MSU’s History Faculty’s virtual library . All texts are in Russian or in Old Russian) . Russian History . ... About Russia under the reign of Alexei Mikhailovich (An account of different aspects of life in the State of Moscow, composed by a Russian Posolski Prikaz (Foreign Office) official emigrating, on the order of a Swedish noble in 1665 (foreign policy registry). ... A manifest, bringing about the emancipation of peasants from serfdom. ...

Еще в разделе: (Показать все результаты (>5) - www.hist.msu.ru/ )

• The Laboratory of Historical Information Sciences
• Moscow State University. Faculty of History. Visiting Scholar's Program

1, 120103 (2012) . ... 2012 120103-1 1, 120103 (2012) . ... xi ,yk ) : i,k =- 3 ( hy 2 i,k-1 - i,k 1 )- 2 i,k-1 . ... 2 2 + 2 i,k = hx2 hy i-1,k +i+1 = hx2 ,k + i,k-1 + hy 2 i,k+1 + i,k . ... 1, 120103 (2012) max 2, max -- ; -- . ... 2012 120103-8 1, 120103 (2012) Numerical mo delling of propagation pro cess and sedimentation of ablated particles in the scheme of a direct laser dusting . ... 492) 247-96-21, e-mail: aantipov@vlsu.ru. 2. -- .-. , ; .: (492) 253-33-58 e-mail: aarak@vlsu.ru. 3. -- ; . ...

Еще в разделе: (Показать все результаты (>2) - uzmu.phys.msu.ru/ )

• http://uzmu.phys.msu.ru/issue/120102.pdf

Research paper Struct Multidisc Optim 27, 435 ­ 445 (2004) DOI 10.1007/s00158-004-0388-x Optimal shapes of parametrically excited beams A.A. Mailybaev, H. Yabuno, and H. Kaneko Abstract Straight elastically supported beams of variable width under the action of a periodic axial force are considered. Two shape optimization problems for reducing parametric resonance zones are studied. In the first problem, the minimal (critical) amplitude of the excitation force is maximized. ...

Еще в разделе: (Показать все результаты (>22) - mailybaev.imec.msu.ru/ )

• http://mailybaev.imec.msu.ru/papers/KirillovEtAl2005.pdf
• http://mailybaev.imec.msu.ru/papers/Mailybaev1999b.pdf
• http://mailybaev.imec.msu.ru/papers/SeyranianMailybaev2001.pdf

... Rod unfortunately was not able to come to Garmisch this year, but has been in touch with the Russian Internet community in Seoul, Sharm el Sheikh, Nairobi, and the United States, and has sent a special letter to Vladislav Petrovich. ... ICANN is working with regional associations and the Internet Society in a global training program that is raising the security awareness and skills of those DNS operators in regions where resources for such training are limited. ...

Еще в разделе: (Показать все результаты (>3) - www.iisi.msu.ru/ )

b e d e v P h y s i c a l I n s t i t u t e o f R A S , M o s c ow 1 27 April, 2012 A l e x a n d e r C h e s n o ko v , M axim Pavlo v (1 L avren t'en tndtico m po fsiH od ro p pno ach s, S ib erian D ivisio n o f R A S , prio,vo si1 2rsk ; 2 S ector o f m o m v I s e t u t e o t i y n a d y r a m ic e 27 A N l 20 bi 1 / 19 Vlasov (Collisionless Boltzmann) Kinetic Equation t ...