... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
Russian TeX Disk . ... Please, use "Save link as" (right mouse button) for downloading files, otherwise binary files will be corrupted. What is russian TeX disk . ... Some TeX versions and tools are installed/russified and can be started directly from CD; other are only distributives plus additional files for their russification. ... FPTEX . ... Directory russian.add: Generic files (mf-sources, pfb-fonts and hyphen file) for russification of any-TeX-realizations in: . ... file readme: . ...
Space Weather . ... Space weather . ... Data . ... You should fill in "Workspace" by groups of data sets to create plots. ... Putting different kind of data into the same plot remember, that the first dropped data set chooses and determines the axis scale for all data. ... If you need both kind of scale in the same plot, create two different plots and unite them. The speed of this service depends on 3 components: data processing on server, data transmission and data plotting in your browser. ...
Ionization Dynamics of Atoms Exposed to Strong Laser Pulses: SemiAnalytical Model at Low Field Frequencies Yu.V. Popov Skobeltsyn Institute of Nuclear Physics, Lomonosov Moscow State University Collaboration B. Piraux, A. Hamido. ... INTRODUCTION AND MOTIVATIONS Keldysh has introduced the adiabaticity parameter = (2Ip)1/2/E where is the laser field frequency, E, the field amplitude, and Ip the ionization potential of the atom. ... Both of them, multiphoton processes and tunnel ionization play a role. ...
... Научные исследований . ... Дмитриев Владимир Иванович : Доктор физико-математических наук, профессор кафедры математической физики, . ... Научные работы : В.И. Дмитриев опубликовал более 400 научных работ, в том числе 22 монографии и учебных пособия. ... Барашков Игорь Сергеевич Кандидат физико-математических наук, старший научный сотрудник. ... Область научных интересов: математическое моделирование сложных физических явлений (плазмофизика, физика твердого тела, геофизика, физика атмосферы). ...
. Главная . История кафедры . Сотрудники кафедры . Новости . Фото недели . Наука . Исследования . Оборудование . Методы . Публикации . Обучение . Программы курсов . Расписание занятий . Полезные ссылки . Контакты . РФФИ . Гранты Президента РФ . Министерство образования и науки РФ . U.S. Department of Health and Human Services . Московский семинар по клеточной биологии . Cell Press Conferences Calendar . PubMed . Scitable .
Welcome to K -corrections calculator, simple service allowing one to determine K -corrections of a galaxy, given its redshift and one or more colours. ... K -correction in choose filter.. ... Redshift . Colour choose colour.. Colour value . Calculator . ... calculate spectral energy distributions , K-corrections calculator , GALEX FUV NUV , UKIDSS YJHK , K-corrections of galaxies , spectral based k-corrections , SDSS filter set K-corrections , K correction code IDL , kcorrect IDL C , . ...
... Each day a different image or photograph of our fascinating universe is featured, along with a brief explanation written by a professional astronomer. September 22, 1998 . M61: Virgo Spiral Galaxy . ... Explanation: M61 is a barred spiral galaxy located in the nearby Virgo Cluster of Galaxies . Visible in M61 are a host of features common to spiral galaxies : bright spiral arms , a central bar , dust lanes , and bright knots of stars. ... About APOD > . ...
... Division of Applied Mathematics, . Faculty of Physics, MSU . ... Prof. A.G. Kushner: "Geometry of Jet Spaces and Applications in Mathematics and Physics" Seminar meeting of the devision of AM 14:00 aud. 4-46 . ... Morozov: "Automation Output Theorems about Conserving the Properties of Mathematical Models" Seminar meeting of the devision of AM 17:00 aud. ... Department of Mathematics, Faculty of Physics, Lomonosov MSU 2014-2016. ...
Лаборатория концентрирования, общая информация . ... общих вопросов аналитической химии (история, терминология, география, кадры, популяризация и др.; академик Ю.А. Золотов); . сорбционного концентрирования элементов, органических соединений и поиска новых сорбентов (группы д.х.н. Г.И. Цизина, д.х.н. С.Г. Дмитриенко, д.х.н. Е.И. Моросановой); . разработки экспрессных тест-методов химического анализа, главным образом вне лаборатории (группы д.х.н. Е.И. Моросановой, д.х.н С.Г. Дмитриенко); . ...
... Геология >> Геотектоника | ... Васильков Ю. В., Василькова Н. Н. Компьютерные технологии вычислений в математическом моделировании. ... Вистелиус А. Б. Основы математической геологии (определение предмета, изложение аппарата). ... Гайдук В. В., Прокопьев А. В. Методы изучения складчато-надвиговых поясов. ... Метод. рекомендации. ... 3-D structural geology: a practical guide to surface and subsurface map interpretation. ... Павлов Д.С. Математический алгоритм построения геологического разреза. ...
SUNY-MSU Partnership . ... MSU | ... The State University of New York/Moscow State University partnership dates back to the mid-1970s and owes its existence to the vision of then MSU Rektor Rem Kokhlov and SUNY Chancellor Ernest L. Boyer. ... The first students were exchanged in 1977. ... A SUNY Center on Russia and the United States opened its doors in January 2000, and a sister MSU Center on the United States and Russia was set up in Moscow at MSU?s newly built Science Park. ... suny-msu . ...
... There are corresponding results showing that the Poincare duals of certain totally ge odesic cycles, which we will call "special cycles", span a definite part (a refined Hodge component) of the cohomology of the locally symmetric spaces of standard arithmetic type associated to the orthogonal groups O(p, q). ... Math. ... KLM3] (with B. Leeb and M. Kapovich) The generalized triangle inequalities in symmetric spaces and buildings with applications to algebra, Memoirs of the AMS, Vol. ...
[
Текст
]
Ссылки http://www.dubrovinlab.msu.ru/files/Alltogether.pdf -- 334.8 Кб -- 15.09.2012
[
Текст
]
Ссылки http://dubrovinlab.msu.ru/files/Alltogether.pdf -- 334.8 Кб -- 15.09.2012 Похожие документы
Create user account [Комиссия, 3 семестр, 2014-2015] . ... Use an existing account . To create an account, please think out, a login and provide your valid e-mail address in the form above. ... This contest operates in \"simplified registration\" mode. ... Accounts created using simplified registration procedure cannot be used for participation in contests, which do not allow simplified registration. If you want a regular account, you may create an account using the regular registration . ...
Sternberg astronomical institute activities on site testing programs review Victor Kornilov comprehensive/characterization/of/astronomical/sites > kislovodsk/russia/2010/october/4-9 > Introduction This presentation responds on our activity in 5 last years only, inspite of that in SAI site testing researches have been started many years ago. ... More detailed discussion is devoted to MASS and DIMM measurements processing, some additional effects which were taken in account in last year. ...
[
Текст
]
Ссылки http://site2010.sai.msu.ru/static/doc/VKornilov_site2010.pdf -- 2488.3 Кб -- 18.10.2010 Похожие документы
... ICONO Invited Speakers . ... Gennadiy Kulipanov, Budker Inst. of Nuclear Physics, Russia . ... Marlan Scully, Texas A&M Univ., ... Andrey Goncharov, Inst. of Laser Physics, Russia . ... Vladimir Trunov, Inst. of Laser Physics, Russia . ... Since 1987, he has worked at the National Research Council of Canada (Ottawa) in the field of laser physics and trapped ion optical frequency standards. ... Alexey Taichenachev , Inst. of Laser Physics, Russia . ... S. Vatnik, Inst. of Laser Physics, Russia . ...