Nanoterrorism: New Responsibility for Our World and Future in the Global TechnoScience Vitaly G. Gorokhov Institute for Philosophy of the Russian Academy of Sciences, Institute of Technology Assessment and Systems Analysis of the Research Center Karlsruhe (Germany) Vitaly.Grorokhov@itas.fzk.de "Bioterrorism and chemical warfare are not unthinkable. ... 2] But these conditions do not else exist for the time being in nanoscience and nanotechnology. ...
[
Текст
]
Ссылки http://www.iisi.msu.ru/UserFiles/File/bayern2009/gorokhov_eng.doc -- 45.5 Кб -- 02.04.2012
[
Текст
]
Ссылки http://www.ipib.msu.ru/UserFiles/File/bayern2009/gorokhov_eng.doc -- 45.5 Кб -- 02.04.2012
[
Текст
]
Ссылки http://iisi.msu.ru/UserFiles/File/bayern2009/gorokhov_eng.doc -- 45.5 Кб -- 02.04.2012 Похожие документы
... Кафедра системного анализа ВМК МГУ . ... О кафедре . ... на кафедру . ... ВМК . МГУ . ... СМУ ВМК . ... Alexandr Borisovich Kurzhanski) . In Russian . ... Kurzhanski was Elected Associate Member of USSR Academy of Sciences (now changed to Russian Academy of Sciences) in 1981 and Full Member in 1990. He is the Chairman of the Russian National Committee on Automatic Control (the IFAC NMO). ... Chairman of Russian National Committee of Automatic Control. ... 4 (8). pp. 100-118. (in russian). ...
Координатор семинара : академик РАН и Academia Europaea Алексей Ремович Хохлов . ... Заседания семинара проводятся в Конференц-зале Института элементоорганических соединений им. А.Н. Несмеянова РАН ( ИНЭОС РАН , г. Москва, ул. Вавилова, 28). ... Скачать объявление о семинаре . ... Б.М. Графов (Интститут физической химии и электрохимии имени А.Н. Фрумкина РАН, Москва) . ... После доклада предполагается обсуждение целесообразности организации Общемосковского семинара по электрохимии. ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
ДД PROCEEDINGS OF THE 31st ICRC, LODZ 2009 1 Preliminary Proton and Helium Spectra from the CREAM-III Flight Y. S. Yoon , H. S. Ahn , T. Anderson, L. Barbier?, ... Keywords: CREAM; energy spectra; protons and helium nuclei I . ... CREAM-III I N S T RU M E N T A N D F LIGHT The CREAM-III instrument consisted of a tungsten/scintillating fiber calorimeter, a dual layer Silicon Charge Detector (SCD), a Cherenkov Camera (CherCam), a Cherenkov Detector, and a Timing Charge Detector (TCD). ...
... Цикл статей «Регулирование активности ДНК-связывающих ферментов» Агапкина Юлия Юрьевна, старший научный сотрудник химического факультета Зацепин Тимофей Сергеевич, научный сотрудник химического факультета 2. статья «Find It If You Can: A Game for Modeling Different Types of Web Search Success Using Interaction Data (Моделирование различных определений ... Цикл статей «Самоаффинные многогранники и аффинные инварианты выпуклых тел. ...
[
Текст
]
Ссылки http://expertise.msu.ru/sites/default/files/2012_deripaska_results.doc -- 151.5 Кб -- 02.01.2013 Похожие документы
NMW survey overview . Access image archive . ... The New Milky Way survey aims to detect bright (V<13.5) optical transients near the Galactic plane using an automated wide-field (8x6 deg.) system capable of surveying the whole Milky Way area visible from the observing site in one night. ... All images obtained during the transient search survey are available online (please use the image archive access form ). ... Images per field: . ... Images per night: . ... Milky Way imaging time: . ...
. КОМПЬЮТЕРЫ . Решение астрономической задачи N тел на кластере из ГПУ (pdf) . Exploring weak scalability for FEM calculations on a GPU-enhanced cluster (pdf) . Using GPUs to Improve Multigrid Solver Performance on a Cluster (pdf) . ClawHMMER: A Streaming HMMer-Search Implementation (pdf) . Проект Folding@Home . Лаборатория Параллельных информационных технологий НИВЦ МГУ .
? ? 1.???????????????? 3 2.Реформа и инновации в сфере государственных услуг в России. 8 3.Особенности развития экономики Шэньчжэня 26 4.в условиях модификации модели роста в КНР 26 5.???????????????? 39 6.СРАВНИТЕЛЬНЫЙ ОПЫТ УЧАСТИЯ РОССИИ И КИТАЯ В ИНСТИТУТАХ ГЛОБАЛЬНОГО УПРАВЛЕНИЯ 41 7.Принципы развития межрегиональных центров подготовки кадров для государственного управления в Российской Федерации 59 8.??????????????? 74 9.Региональные особенности государственного регулирования сферы образования в РФ 82
. Webcams . Networking . Weather . Power . System health . Measurements . Sky status at Sat Apr 9 22:28:00 2016 is Clear Sky status at Sat Apr 9 22:28:00 2016 is Clear . Copyright 2007 2013.
... info@ecfs.msu.ru . ... Topic 2: Barriers to Sustainable Soil.. ... We are inviting you to participate in our consultation on "Barriers to Sustainable Soil Management in Eurasia and possible ways for overcoming them".љ ... Is workforce capacity in the Eurasian region sufficient for adopting sustainable soil management practices? ... Мы приглашаем вас принять участие в нашей консультации "Барьеры на пути к устойчивому землепользованию в Евразии и возможные пути их преодоления".љ ... Topic 2 . ...
... ЛЕКЦИИ . МАЛЫЙ МЕХМАТ - ШКОЛЕ . ... Лекция 1 (44) 6.10.2001 . ... профессор мехмата МГУ. ... На этом и на теореме Эйлера (обобщении малой теоремы Ферма) основана система шифрования RSA, о которой было рассказано на лекции. Познакомиться с этой системой можно, например, по статье 'Малая теорема Ферма' В. Сендерова и А. Спивака, опубликованной в первом, третьем и четвертом номерах 'Кванта' за 2000 год. ... Лекция 13 (56) 16.02.2002 . ... доцент кафедры газовой и волновой динамики мехмата МГУ; . ...
Fluctuation in EAS development and estimates of energy and composition of the primary radiation by L. Dedenko, SINP, MSU 1) surface scintillation detectors (SD) 2) detectors of the Vavilov-Cherenkov radiation (VCR) 3) underground detectors of muons (UD) (with the threshold energy ~1 GeV). Yakutsk array Detectors readings · The various particles · of Extensive Air Showers (EAS) · at the observation level · hit detectors · and induce some signals sampled as · detector readings 18.05.2011. IWS. ...
... Звезды типа Миры Кита и полуправильные Среди пульсирующих переменных звезд поздних классов видное место занимают долгопериодические переменные звезды (ДПП). ... Изменения блеска мирид происходят более или менее регулярно, периоды большинства мирид находятся в интервале от 150 до 600 суток ( рис. ... В 4-м издании Общего каталога переменных звезд (ОКПЗ) ДПП (включая переменные типа Миры Кита, или мириды, и полуправильные переменные поздних классов) составляют самую многочисленную группу переменных. ...
... История кафедры . ... S. Auclair, R. Uzbekov, S. Elis, L. Sanchez, I. Kireev, L. Lardic, R. Dalbies-Tran, and S. Uzbekova. ... I. Vorobjev, K. Buchholz, P. Prabhat, K. Ketman, E. Egan, M. Marti, M. Duraisingh, and N. Barteneva. ... Belmont AS, Hu Y, Sinclair PB, Wu W, Bian Q, Kireev I. Insights into Interphase Large-Scale Chromatin Structure from Analysis of Engineered Chromosome Regions. ... Цитология, (2010), т. 52, ? ... Hu Y., Kireev I., Plutz M., Ashourian N., Belmont AS. ... 2008), 5(4):311...
Strict Standards : Non-static method JLoader::import() should not be called statically in /wcmc/ms/ms/libraries/joomla/import.php on line 29 . Strict Standards : Non-static method JLoader::register() should not be called statically in /wcmc/ms/ms/libraries/loader.php on line 71 . ... Deprecated : Non-static method JFactory::getConfig() should not be called statically, assuming $this from incompatible context in /wcmc/ms/ms/libraries/joomla/application/application.php on line 726 . ...