... Air temperature in the forechamber: 285-295K . ... Aerodynamic unit AR-2 is used for experimental research of heat and mass exchange processes in a model boundary layer, flown over by supersonic air stream. The main part of the unit is supersonic aerodynamic tube of continuous action with regulated plate nozzle, rectangular cross-section of the working part 100x70 and with regulated exit cone. ... Unit AR-2 is a supersonic aerodynamic tube with a regulated supersonic nozzle and an exit cone. ...
... Director of the Institute of World Culture . Member of Russian Academy of Sciences . ... Moscow State Lomonosov University (MGU); Institute of Slavic Studies of the Russian Academy of Sciences; Russian State Humanities University (RGGU); University of California, Los Angeles (UCLA), Department of Slavic Languages and Literatures and Indo-European Studies Program. ... Director of the Research Institute of World Culture of the Moscow Lomonosov State University (MGU), 1989-present. ...
... Aptamer DNA : A New Type of Thrombin Inhibitors V. A. Spiridonova*,1 E. V. Rog**, T. N. Dugina***, S. M. Strukova***, and A. M. Kopylov** *Belozersky Institute of Physicochemical ... State University, Vorob'evy gory, Moscow, 119899 Russia Received November 13, 2002; in final form, November 21, 2002 Abstract--The formation of complexes between various thrombin preparations and 30-mer aptamer DNA was comparatively studied, and a correlation between the ... 5 2003 Vol. ... Vol. ...
THE FIRST JAPAN-RUSSIA MEDICAL FORUM PROGRAM Date: December 10, 2012 Venue : Intellectual Center - Fundamental Library of Lomonosov Moscow State University Bld.27, Lomonosovskiy prospect, Moscow , 119991, Russia Organizers: Lomonosov Moscow State University Tohoku University Supported by Embassy of ...
[
Текст
]
Ссылки http://www.fbm.msu.ru/upload/news/2012/12-05/progr.doc -- 30.5 Кб -- 06.12.2012
[
Текст
]
Ссылки http://fbm.msu.ru/upload/news/2012/12-05/progr.doc -- 30.5 Кб -- 06.12.2012 Похожие документы
trendence Graduate Barometer Europe 2011 About the survey About trendence trendence Graduate Barometer Europe is an annual online student survey which allows students to express their opinion on topics re lated to career and education. ... Ulrike Heyne Project Manager trendence Graduate Barometer Europe 2011 About the survey Facts and benefits How does it work? ... If your students take part in the trendence Graduate Barometer, they will receive an exclusive Student Report. ...
[
Текст
]
Ссылки http://studsov.math.msu.su/Sites/studsovet/Uploads/trendence_GBE_2011_-_About_the_survey.docs1.pdf -- 209.6 Кб -- 20.10.2012 Похожие документы
Studying at MU Programs and degrees . ... Moscow State University provides a wide range educational services and educational programmes. ... International students are offered Bachelour (4 years full time) and Master programmes (2 years full time). A number of our faculties train both domestic and international students according to Bachelour and Master programmes with granting Bachelour and Master diplomas. ... Please, contact International Students Office for information on the topics offered. ...
... Геология >> Геология океанов и морей | ... Богданов Ю. А., Гидротермальные рудопроявления рифтов Срединно-Атлантического хребта, 166 с., Научный Мир, Москва, 1997. ... Эволюция осадочного рудообразования в истории Земли, Ред. ... Деков В. М., Гидротермальное осадкообразование в Тихом океане, 208 с., Наука, Москва, 1994. ... Геологическая история океана, сер. ... Лисицын А. П., Богданов Ю. А., Гурвич Е. Г., Гидротермальные образования рифтовых зон океана, 256 с., Наука, Москва, 1990. ...
. Евгений Вареник, 28 февраля 2006 . Схема Горнера вычисления значения полинома в точке. Доказательство ее оптимальности в худшем случае по числу операций "сложение" и "умножение" среди алгоритмов, использующих только эти операции. Материалы к докладу: . E.M. Reingold and A.I. Stokes, Simple proofs of lower bounds for polynomial evaluation, in: R.E. Miller and J.W. Thatcher, Eds., Complexity of Computer Computations (Plenum, New York, 1972) 21--29.
The Database of Close Binary Systems . ... Team . ... This web-based interactive database is being developed and maintained by a team at the Sternberg Astronomical Institute of the Moscow State University . The project is an on-line extension of our catalogue on "Highly Evolved Close Binary Stars" (volumes I, II) published by Gordon and Breach in 1996. As of September 2009, the database (both the software and the content) is in its development/testing phase. ...
. Search: . Login . Preferences . About Trac . Timeline . Roadmap . Browse Source . View Tickets . Search . Reverse Diff . (No files) . Note: See TracChangeset for help on using the changeset viewer. Unified Diff . Zip Archive . Powered by Trac 0.12.5 . By Edgewall Software . Visit the Trac open source project at . http://trac.edgewall.org/
... A dimension that, arguably, has so far not received the attention it deserves, namely: the role of research and education in fighting the spread of terrorist ideology and enhancing information security. ... To conclude, I will make some concrete suggestions about what kind of research we need and what kind of educational programmes we should develop to address the spread of terrorist ideology and to enhance cyber security. ... Ideology can potentially play different roles in the context of terrorism...
[
Текст
]
Ссылки http://www.iisi.msu.ru/UserFiles/File/bayern2009/perl.doc -- 222.0 Кб -- 02.04.2012
[
Текст
]
Ссылки http://www.ipib.msu.ru/UserFiles/File/bayern2009/perl.doc -- 222.0 Кб -- 02.04.2012
[
Текст
]
Ссылки http://iisi.msu.ru/UserFiles/File/bayern2009/perl.doc -- 222.0 Кб -- 02.04.2012 Похожие документы
... 1998 1 : Defended the Doctorate Degree Thesis on "Models of Cosmic Ray Particle Fluxes (Development and Applications)". ... Space Weather . ... Nymmik R.A., Radiation Environment Induced by Cosmic Ray Particle Fluxes in International Space Station Orbit According to Recent Solar and Galactic Cosmic Ray Models, Adv. ... Nymmik R.A., Radiation Environment Induced by Cosmic Ray Particle Fluxes in International Space Station Orbit According to Recent Solar and Galactic Cosmic Ray Models, Adv.Space Res. ...
Information letter Dear colleagues! Faculty of Basic Medicine, Lomonosov Moscow State University and State Research Center Institute for Biomedical Problems, Russian Academy of Science would like to invite you to participate in the work of the VII Russian National School with International Participation on Muscle and Exercise Physiology «New approaches to studying of classical problems». ... Abstracts of reports will be published. ... The receipt of your abstract will be confirmed by e-mail. ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
1 Вопрос: в каких случаях выгоднее использовать аппаратный маршрутизатор, а в каких -- программный? 1 Ответ: прикидывать по деньгам * в самых простых случаях лучше купить железяку за 50уе (рек. [[ http ://www.dlink.com/][D-Link]]) * в средних случаях _дешевле_ использовать [[ http ://www.freebsd.org/][ FreeBSD5 ]] * в тяжелых случаях (когда может не потянуть шина/процессор/память ядра лучше купить железяку за 50k+уе ([[ http ://www.cisco.com/][Cisco]], [[ ...
... 37, No. 1, pp. 312. i Star Formation History at the Centers of Lenticular Galaxies with Bars and Purely Exponential Outer Disks from SAURON Data O. K. Sil'chenko1* and I. V. Chilingarian1, 1 2 Sternberg Astronomical Institute, Universitetskii pr. ... DISCUSSION In all seven galaxies with exponential outer stellar disks for which we analyzed the stellar population properties at the center based on the SAURON data, we detected chemically decoupled nuclei. ... Astron. ... O. K. Sil'chenko, Astron. ...
hpc@cmc . Высокопроизводительные вычисления на ВМК МГУ . Blue Gene/P . Regatta . ... Серия Blue Gene в мире . ... Факультет вычислительной математики и кибернетики МГУ . ... parallel.ru . ... Parallel Computing . ... Некоммерческое программное обеспечение Intel : . ... Часть ссылок и описаний к ним любезно предоставлена администратором сайта кафедры АНИ факультета ВМК МГУ имени М. В. Ломоносова . Факультет ВМК МГУ . ... 2008 2013 Факультет ВМК МГУ имени М. В. Ломоносова . ...