Lomonosov Moscow State University . ... About Us . ... Academic Programs . ... Russian Language Program . ... The Faculty of Foreign Languages was founded at Moscow State University in 1988. ... I am glad to note that the alumni of the Faculty of Foreign Languages of Moscow Stale University meet these high criteria. ... Faculty of Foreign Languages and Area Studies Lomonosov Moscow State University: . ... 2000 - 2016 Faculty of Foreign Languages and Area Studies Lomonosov Moscow State University . ...
... MOIP (Moscow Society of Naturalists) is a unique social phenomenon in Russia?s life. ... Great scientists and thinkers such as academicians V.I. Vernadskiy and N.D. Zelinskiy presumed that MOIP acted in Moscow as the Academy of Sciences up to the Saint-Petersburg (Russian) Academy moving to the capital in the thirties of 20 th century. In the course of all these years, the Moscow Society of Naturalists united and coordinates almost all scientific potencies in the sphere of natural science. ...
... All rights reserved 0301-5629/98/$see front matter PII S0301-5629(98)00110-0 Original Contribution SHEAR WAVE ELASTICITY IMAGING : A NEW ULTRASONIC TECHNOLOGY OF MEDICAL DIAGNOSTICS A RMEN P. SARVAZYAN,* OLEG V. RUDENKO, SCOTT D. SWANSON, J. BRIAN F and STANISLAV ... Engineering Department, University of Michigan, Ann Arbor, MI (Received 5 September 1997; in final form 2 July 1998) Abstract-- Shear wave elasticity imaging ( ... Schematic presentation of shear wave elasticity imaging....
[
Текст
]
Ссылки http://acoustics.phys.msu.su/teachers/rudenko_files/98sweisarv.pdf -- 718.4 Кб -- 12.10.2007
[
Текст
]
Ссылки http://acoustics.phys.msu.ru/teachers/rudenko_files/98sweisarv.pdf -- 718.4 Кб -- 12.10.2007 Похожие документы
... Квантовая теория . ... КВАНТОВАЯ ТЕОРИЯ ПОЛЯ [7-й-8-й семестры] (проф. СЛАВНОВ Д.А.) . ... СОВРЕМЕННЫЕ ТЕОРЕТИЧЕСКИЕ ПРОБЛЕМЫ ФИЗИКИ ВЫСОКИХ ЭНЕРГИЙ [10-й семестр] (с.н.с. САМОХИН А.П.) . ... проф. СЛАВНОВ Д.А. Квантовая теория поля описывает фундаментальные законы современной физики. ... Квантовая теория поля является теоретической основой физики высоких энергий и физики элементарных частиц. ... Квантовая теория поля и физика фундаментальных взаимодействий. ... Введение в квантовую теорию поля. ...
... Доктор филологических наук профессор Юрий Николаевич МАРЧУК является видным специалистом по прикладной и компьютерной лингвистике , машинному переводу, автоматическому анализу и синтезу текстов, терминологии и терминоведению, лексикологии и лексикографии, общему языкознанию. ... Белов Алексей Михайлович, преподаватель, кандидат филологических наук . ... Качалкин Анатолий Николаевич, профессор, доктор филологических наук . Кочергина Вера Александровна, профессор, доктор филологических наук . ...
... Разработка и внедрение образовательных программ повышения квалификации специалистов в области инновационной деятельности . ... Master Degree in Geology . Master Degree in Management . Master Degree in Chemistry . ... 06/04/2016 . ... 29 марта 2016 г. День открытых дверей Высшей школы инновационного бизнеса . ... 27 марта 2016 года Московский государственный университет имени М.В.Ломоносова приглашает на весенний ДЕНЬ ОТКРЫТЫХ ДВЕРЕЙ . ... New technologies in gas chemistry . ...
Химический факультет МГУ им. М.В. Ломоносова Миняйлов В.В. Тестирование учащихся в системе дистанционного обучения химического факультета МГУ www.chem.msu.su/rus/do/ Учебно-методическое пособие [pic] 2006 г. Содержание Вход в систему дистанционного обучения (СДО) химического факультета МГУ 2 Обучение 5 Выполнение теста 5 Выбор одного ответа из предлагаемых вариантов 5 Выбор несколько ответов из предлагаемых вариантов 6 Ввод ответа с клавиатуры. ... Рис. ... pic] |Сортировка записей в списках | ...
... О кафедре . English . ... Department for Jewish Studies of Lomonosov Moscow State University . ... The Department for Jewish Studies (DJS) was established in 1998. ... The students take courses offered by the School (the Institute of Asian and African Studies), as well as courses offered by the Jewish Studies Department. ... The Department regularly accepts university teachers of Jewish and Israeli Studies from Russia and the FSU in order to upgrade their professional level. ...
Faculty of Global Studies, Lomonosov Moscow State Uiversity Information Sheet 2014- 2015 GENERAL INFORMATION University Website Faculty Website for Exchange Students Academic Guide for Exchange Students Mailing Address of the Faculty (for courier delivery as well) Contact Information of the international department of the Faculty http://www.msu.ru/ http://fgp.msu.ru/ http://fgp.msu.ru/ru/ ... The faculty provides exchange students with the dormitory. ...
[
Текст
]
Ссылки http://fgp.msu.ru/wp-content/uploads/2014/03/Information-Sheet.pdf -- 236.9 Кб -- 06.02.2015 Похожие документы
... Елена Фоменко (2 курс). ... Руководитель В. И. Буник, отдел биокинетики НИИ ФХБ им. А.Н.Белозерского МГУ. ... Руководитель А.Г. Евстафьева, отдел химии и биохимии нуклеопротеидов НИИ ФХБ им. А.Н. Белозерского МГУ. ... Руководитель Н.В. Чичкова, лаборатория молекулярной биологии гена отдела химии и биохимии нуклеопротеидов НИИ ФХБ им. А.Н. Белозерского МГУ. ... Руководитель А.Г. Евстафьева, лаборатория молекулярной биологии гена отдела химии и биохимии нуклеопротеидов НИИ ФХБ им. А.Н. Белозерского...
... Science Park . ... Agency for networking, information and communication technologies ( NETINFOKOM LLC) ank-nic@rambler.ru http://www.msunews.ru/ . ... Developing the infrastructure and information support needed for projects that provide an interdisciplinary exchange of science information and the potential for collective work on the base of network services and technologies. ... The company has a great deal of experience in the design, development and penetration of laboratory information systems. ...
... Preliminary evaluation of forest ecosystems' state near the smelter was made, the monitoring methodology for polluted areas was developed, and critical loads of acid deposition were assessed (see also soil.msu.ru/projects/acidification/ ). ... The new built up database on forest ecosystem data for permanent monitoring plots was used for analysis of soil chemical state in forest ecosystems subjected to airborne pollution in the fragile boreal environment in the Norwegian-Russian border area. ...
О кафедре . ... Главная -> Учебный процесс -> Лекционные курсы -> Пакеты прикладных программ -> Программа курса . Лекционные курсы . ... Языки программирования и библиотеки подпрограмм для численных расчетов ( библиотека численного анализа НИВЦ МГУ, NAG Library, Netlib ). ... Системы компьютерной алгебры и универсальные системы численных расчетов ( Maple, Mathematica, Matlab, Mathcad ). ... Учебный курс. ... 2002 2016 Кафедра Оптимального управления факультета ВМиК МГУ . ...
... Сектор информатики и биофизики сложных систем . ... О секторе . ... Учебная работа сектора включает лекции, семинары, практические занятия по информатике и математическому моделированию в биологии, биофизике, экологии на всех 5-ти курсах обучения на кафедре биофизики. ... Диффузия и взаимодействие белков в биологических мембранах? консультанты Ризниченко Г.Ю. , Рубин А.Б. Рабочие семинары сектора информатики и биофизики сложных систем проходят по четвергам в 11:00 в аудитории 124 (компьютерный класс...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... Earlier still lies the remaining frontier, where the first stars, galaxies and massive black holes formed. ... Building on this general framework, and relying on the development of efficient new computational tools, the fragmentation properties of primordial gas inside such minihaloes were investigated with numerical simulations, leading to the result that the first stars, so-called population III, were predominantly very massive4,8 (see Box 1 for the terminology used here). ... Astrophys. ... III. ...
[
Текст
]
Ссылки http://ocean.phys.msu.ru/courses/geo/lectures-addons/02/2009%20Bromm%20et%20al.%2C%20The%20formation%20of%20the%20first%20stars%20and%20galaxies.pdf -- 799.2 Кб -- 28.08.2009 Похожие документы