УЧЕБНОЕ ПОСОБИЕ ПО АНГЛИЙСКОМУ ЯЗЫКУ ДЛЯ СТУДЕНТОВ-ГЕОЛОГОВ 1 КУРСА ЧАСТЬ 1 Н.Г.КИТКОВА, Т.Ю.САФЬЯННИКОВА Рецензенты: Д.г.-м.н., профессор МГУ имени М.В.Ломоносова Н.В.Короновский К.ф.н., заведующая кафедрой иностранных языков РГГУ нефти и газа имени Губкина Е.Ю.Симакова Содержание Introductory Section A scientist Studies Science Section I. Meet the Sciences Unit I: What is Science? Unit II: Geology as a Science Unit III: Branches of Geology Unit IV: The Importance of being a Geologist Unit V: Revision
[
Текст
]
Ссылки http://www.geol.msu.ru/obsh/uch_ch1.doc -- 1082.0 Кб -- 08.04.2016
[
Текст
]
Ссылки http://geol.msu.ru/obsh/uch_ch1.doc -- 1082.0 Кб -- 08.04.2016 Похожие документы
... Русский English . Background . ... The Faculty of Bioengineering and Bioinformatics, Lomonosov Moscow State University was founded in 2002 with the express purpose of training of highly qualified personnel for the universities, research institutes, medical companies and facilities, and pharmaceutical and biotechnology industries. ... Each of FBB students is to successfully complete and defend three yearly research projects, in bioinformatics, biochemistry, and bioengineering. ...
... News . ... Second-year students classes . ... Since 1993 lecturers of the MSU Faculty of Physics have been reading a course on ?Programming and Information Technology?. ... In 2008 the Dean of the Faculty of Physics approved a new curriculum, which allowed advanced second-year students to take a course in one of the following disciplines instead of the basic programming course: Microcontroller Programming , FPGA Design , Parallel Programming , and Computer-Aided Science Engineering (CASE) . ...
Lomonosov project . News . ... Mikhail Lomonosov . Scientific goals . ... Scientific equipment . ... July 8, 2012 . ... May 10, 2012 . The entrance control of cable system of scientific equipment ?Lomonosov? successfully completed. ... Input control tests of scientific equipment ?Lomonosov? devices is held in NIIEM. December 15, 2011 . Preparations for testing the dynamic module of scientific instruments for satellite ?Lomonosov? is finished. November 30, 2011 . ...
... Data . ... Planetary perturbations during geomagnetic storms are measured by the Dst index, which is the deviation of variation of the magnetic field from the undisturbed level, averaged over the values measured at the control chain of magnetic stations located in the low latitudes. ... To predict the hourly values of the Dst index, artificial neural networks (ANN) of perceptron type are used. ... Loading of the data on the values of the Dst index and forecast update are performed twice per hour. ...
... Programme Committee . ... Scientific Programme . Programme . ... Social Program . ... May 20, 2012 - confirmations from invited speakers . July 5, 2012 - deadline for abstract submission . July 7, 2012 - preliminary program . July 10, 2012 - deadline for registration . July 25, 2012 - final program . ...
... International Olympiad БЂњNanotechnologies БЂ“ Breakthrough to the Future!БЂќ . ... The Olympiad allows the participation of primary, secondary and high school students, BSc, MSc, PhD students, young scientists, teachers and tutors, or enthusiasts of materials sciences and nanotechnologies . ... The site www.nanometer.ru is the official portal of the International Olympiad on nanotechnologies БЂњNanotechnologies БЂ“ Breakthrough to the Future!БЂќ . ...
... February 9, 2004 . ... 9.02.2004 . 10 th Anniversary of the Golden Mask Festival . In spring 2004 the National Theatre Award and Festival 'Golden Mask' celebrates its 10th anniversary. ... This program marks the 10th anniversary of the Golden Mask Festival. (more.. ... The use of foreign words where suitable Russian ones exist has been forbidden under a new law passed by the Russian parliament. ... Russian proverbs and sayings about Russian language: . ...
Базы данных по социально-экономической статистике . ... Представлена характеристика средств визуального анализа статистических данных, реализованных в рамках проекта. ... Реляционная база данных "Интерактивная статистика Российской Федерации . ... Модуль отображения данных на карте, полностью интегрированный с реляционной базой данных, предоставляет пользо-вателю возможность оперативно вывести в форме картограммы любой показатель из сводной таблицы, построенной в результате запроса. ...
A full system of equilibrium differential equations for the finite number of suspension lines (n = 28) of square parachute is derived. ... One can determine the shapes of inflated canopy radial cross-sections, stress distribution of radial ribbons on the canopy surface and fabric stress between them, drag coefficients for various line lengths and air-permeability by means of computer simulation. ... Initially, this problem was solved assuming D p = const over total canopy of square parachute. ...
TITLE OF THE ABSTRACT FIRST I. AUTHOR1, SECOND I.J. AUTHOR2 AND THIRD AUTHOR2 1Organization name of the first author first_ author@email.ru 2Organization name of the second and third authors second.author@email.com, third_author@mail.eu Key words: list up to eight words or group of words in order of priority, separated by commas. ... The abstract including figures, tables and reference should not exceed 1 page. The title should be centered in the page, in 11pt, boldface Roman, all capital letters. ...
... The subjects of the Colloquium-458 cover important problems dealing with the verification of constitutive equations, the organization of experiments, the connection between microstructures and mechanical properties and the effective utilization of the modern FEM packages. ... Institute of Mechanics, Lomonosov Moscow State University, Michurinsky Prospekt, 1, 117192, Moscow, Russia . ... S.-Petersburg, 195251, Russia. ... Institute for Problems in Mechanics of Russian Academy of Sciences . ...
... A p P EC Astropar ticle Physics for Europe · Cosmic rays: A large array for the detection of charged cosmic rays ( Auger North) · Gamma rays: A large array of Cherenkov Telescopes for detection of cosmic high energy gamma-rays ( CTA ) · High energy neutrinos: A cubic kilometre-scale neutrino telescope in the Mediterranean (KM3NeT) · Dark matter search: Ton-scale detectors ... A p P EC Astropar ticle Physics for Europe · Cosmic rays: AMS detector launched. ...
? ? 1.???????????????? 3 2.Реформа и инновации в сфере государственных услуг в России. 8 3.Особенности развития экономики Шэньчжэня 26 4.в условиях модификации модели роста в КНР 26 5.???????????????? 39 6.СРАВНИТЕЛЬНЫЙ ОПЫТ УЧАСТИЯ РОССИИ И КИТАЯ В ИНСТИТУТАХ ГЛОБАЛЬНОГО УПРАВЛЕНИЯ 41 7.Принципы развития межрегиональных центров подготовки кадров для государственного управления в Российской Федерации 59 8.??????????????? 74 9.Региональные особенности государственного регулирования сферы образования в РФ 82
... The optimal control, which led oscillatory system to a certain energy level from any initial conditions at minimum time, is found. ... A set of points where the trajectory becomes an arc of a circle with the other center is called the switching line. ... For drawing switching line near the origin (see for example Figure 3) we note from the system (1) that time is proportional to the sum of the angles 214 this sums for optimal and quasi-optimal processes. ... The control function (14) is not optimal....
... An extended set of observables of the nuclear quasi-free (p, d + ) reaction including the triple differential cross-section for coincidence measurements, its analyzing power in case of polarized proton beams and, also, the parameters of the polarization of the excited recoil nucleus and the produced deuteron are considered in the framework of the distorted-wave impulse approximation using the reaction 16 O(p, d + )15 N at a proton energy of 650 MeV as an example. ...
[
Текст
]
Ссылки http://np-chair.sinp.msu.ru/download/epja100510-offprints.pdf -- 426.2 Кб -- 18.03.2015 Похожие документы
... Спивак М.Л. Издательские проекты 'Мемориальной квартиры Андрея Белого (1995 - 2015) // Сборник статей Государственного музея А.С. Пушкина. ... Наседкина Е.В. Материалы из фонда 'Мемориальной квартиры Андрея Белого'. ... Андрей Белый. ... Андрей Белый в изменяющемся мире: к 125-летию со дня рождения / Составители: М.Л. Спивак (ответственный редактор), Е.В. Наседкина, И.Б. Делекторская; Научный совет РАН 'История мировой культуры'; ГМП. ... Спивак М.Л. Андрей Белый - мистик и советский писатель. ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... 10 (Unit) . ... Overview of Chemistry 1. ... 2-5. : . ... Unit 2 History of Chemistry 7. ... 11 Unit 3 The Periodic Table and the Periodic Law 14. ... Unit 4- Matter in the Universe 20. ... Revision and Development. ... 4, 5 Unit 5- Why is Water Important. ...
The Early Music Theatre >> Repertoire >> Poorhero Miss-the-target . ... Catherine II wrote librettos for five operas: "Hero Boleslavich of Novgorod" by Fomin, "Poorhero Miss-the-Target" by Martin y Soler, "Early Years of Oleg's Reign" by Sarti, Canobbio and Pashkevich. The first night of the opera "Poorhero Miss-the-Target" was on January 20, 1789 at the Hermitage Theatre. ... Martin y Soler's music was elegant and natural, it helped to hide a lot of drawbacks of contemporary opera librettos. ...