home | ... contacts | Ilyukhina Ekaterina Anatol'evna . ... Organic Chemistry Division, Chemistry Department, Lomonosov Moscow State University, Leninskie Gory, 199899 Moscow, Russia. ... 7(095)939-55-46 . ... Study at the Department of Chemistry, Lomonosov Moscow State University, Moscow Field of scientific interests: . ...

Еще в разделе: (Показать все результаты (>3) - www.mgumus.chem.msu.ru/ )

• MGUMUS -- Matvey V. Youdov

... Cultural Mediation of National History and Identity . ... Second International Conference in Tampere , Finland . ... This sense of national identity, of history and possible futures, is communicated by cultural and institutional forces and integrated, individually and collectively, into our sense of a common shared nationhood. ... Through a semiological analysis of television texts, it is demonstrated how, by a re-interpretation of Russian history, new cultural and national identities are...

Еще в разделе: (Показать все результаты (>22) - psyberlink.flogiston.ru/ )

• Уильямс Л. Фетишизм и визуальное удовольствие тяжелого порно: Маркс, Фрейд и
• Психология XX столетия: итоги. Ресурсы
• Библиография по экономической психологии

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>3) - mouse.genebee.msu.ru/ )

звоните, мы в Москве(926)6667253 art-sale@mail.ru . Начало www.99ru.ru Виниловые пластинки Запад 15614 . ... Искусство . История.Философия . ... Художественные . ... История Всемирная . ... Искусство и культура . ... Другие виды искусства . ... Теория искусств.Эстетика . ... Этнография Фольклор . ... Наследие Востока . ... Фольклор . ... СССР (после 1917) . ... Введите код товара из каталога. автор Kraftwerk . ... Западных уже нет, остались кое-какие лицензионные СССР звоните, тел.сверху . ...

Еще в разделе: (Показать все результаты (>15) - www.bukivedi.ru/ )

• www.99ru.ru - Radiohead 15841
• www.99ru.ru - Winifred Gallagher 3889

... E-mail: Tchytannya@gmail.com Website of the Conference: www.tchytannya.org.ua Mailing address: National University "Law Academy of Ukraine named after Yaroslav Mudriy", Department of the Constitutional Law of Ukraine, organizing committee of The International Science Conference of Young Scientists, Researchers, Postgraduates and Students "Values of modern constitutionalism (V Todyka's readings)" Pushkinska street, 77, Kharkiv, 61024, Ukraine. ...

Еще в разделе: (Показать все результаты (>8) - www.law.msu.ru/ )

• http://www.law.msu.ru/bitcache/da2ecb4c4c1ad0c8d4c795e346afcf80b93bd045?vid=25267&disposition=attachment&op=download
• http://www.law.msu.ru/doc/maleshin-rus-civil-proc.pdf

... Monitoring of relativistic electron fluxes in the near-Earth space. Development of the methods for studying of relativistic electrons of fluxes in the regions of precipitation. Studies of the fluxes and spectra of high-energy electrons of the outer radiation belt of the Earth. ... Studies of the fluxes and spectra of high-energy electrons in the low-latitudinal regions (at small L). ... Studies of VLF electromagnetic radiation generated during the main phase of the lightning discharge. ...

Еще в разделе: (Показать все результаты (>3) - vernov-relec.sinp.msu.ru/ )

... Unemployment of graduates combined with a shortage of highly educated young people is putting the European governments under pressure to act. ... The Bologna Declaration explicitly mentions the lack of competitiveness of European Higher Education institutions. The signatory countries actually explicitly express their goal to "ensure that the European higher education system acquires a world- wide degree of attractiveness equal to [Europe's] extraordinary cultural and scientific traditions". ...

Еще в разделе: (Показать все результаты (>4) - www.edst.msu.ru/ )

• http://www.edst.msu.ru/conf/docs/USA-2002%2B.doc

... О кафедре . Кафедра суперкомпьютеров и квантовой информатики . ... Кафедра проводит обучение по образовательной программе шестилетней интегрированной подготовки высококвалифицированных специалистов с последовательным освоением образовательной программы бакалавриата (4 года) по профилю ?Системное программирование и компьютерные науки? и образовательной программы магистратуры (2 года) по двум магистерским программам: ?Суперкомпьютерные системы и приложения? и ?Квантовая информатика?. ... ИПМ РАН . ...

Еще в разделе: (Показать все результаты (>3) - sqi.cs.msu.su/ )

• Учебно-методические комплексы по курсам, читаемым преподаватлями кафедры ?

... The Faculty of Materials Science General Information . ... Students complete a number of special theoretical and practical training courses with the best MSU professors to have advanced training in mathematics, chemistry, physics and mechanics. ... Such a small student admission is a deliberate choice intended on individual training program for each student. The main advance in education is extensive emphasis on research and creativity that facilitates scientific results of the students. ...

352. Laser-Electron X-Ray Source for Medical Applications | Проект ЭЛЛАРИ

353. EDAS2 - Alternative Splicing DataBase.

354. http://polit.msu.ru/pub/ACPD_2013.doc

355. Интернет

356. Факультет фундаментальной медицины МГУ

357. MSU Chamber Orchestra. Hystory.

358. http://www.radio-msu.net/serv/wwwtrace/tracelist.html