faq ]] . CompHEP . ... Installation . ... Q: When I try to display squared diagrams for 6 final particles the CompHEP stops . ... Read the FAQ page, . ... Old versions of CompHEP (e.g. 33.23, see the 'Downloads' page) could be installed on HP, SUN and DEC platforms. ... The installation of some versions earlier than 4.4 on 64bit lxplus.cern.ch machines, where 32bit libisajet and libmath from cernlib are found by ./configure in the directory /cern/pro/lib may require the following steps: . ...

Еще в разделе: (Показать все результаты (>27) - comphep.sinp.msu.ru/ )

• download:rn-070605 [CompHEP]
• overview [CompHEP]
• download:main [CompHEP]

... Version 1.2 of MPI . ... This section contains clarifications and minor corrections to Version 1.1 of the MPI Standard. The only new function in MPI-1.2 is one for identifying which version of the MPI Standard the implementation being used conforms to. There are small differences between MPI-1 and MPI-1.1. There are very few differences (only those discussed in this chapter) between MPI-1.1 and MPI-1.2, but large differences (the rest of this document) between MPI-1.2 and MPI-2. ...

Еще в разделе: (Показать все результаты (>595) - www.parallel.ru/ )

• Installing documentation | PARALLEL.RU - Информационно-аналитический центр по
• Problems starting programs | PARALLEL.RU - Информационно-аналитический центр по
• Automatic generation of profiling libraries | PARALLEL.RU -

... About lab . ... The LidarK library provides an open-source framework for processing multidimensional point data such as 3D LIDAR scans. ... Download LidarK 2.0 , or browse for the previous versions and data samples . ... We called the data structure we designed Seg-Tree . ... GML LidarK Library v. 2.0 September 10, 2010 Download . GML LidarK Library v. 1.2 December 5, 2008 Download . GML LidarK Library v. 1.1 September 9,2008 Download . GML LidarK Library v. 1.0 July 1, 2008 Download . ...

Еще в разделе: (Показать все результаты (>279) - graphics.cs.msu.ru/ )

• GML LidarK Library | Лаборатория компьютерной графики и мультимедиа
• GML MatLab Camera Calibration Toolbox | Graphics and Media Lab
• GML MatLab Camera Calibration Toolbox | Лаборатория компьютерной графики и

... Ribonuclease H-like motif . ... Ribonuclease H-like . ... Ribonuclease H . protein domain . ... HIV RNase H (Domain of reverse transcriptase) . Human immunodeficiency virus type 1 [TaxId: 11676] . ... BH0863-like Ribonuclease H . Bacillus halodurans [TaxId: 86665] . ...

Еще в разделе: (Показать все результаты (>5782) - monkey.belozersky.msu.ru/ )

• SDPpred
• DNA/RNA-Protein structures
• NPIDB project. Introduction

Laboratories \ Laboratory of morphological adaptations of vertebrates \ Publications . ... Publications . ... Sokolov V.E , Chernova O.F., Fekadu Kassaye. ... Moscow: Institute of Evolutionary Animal Morphology and Ecology, 1994. 147 p. Chernova O.F. Spine architectonics in some rodents (Rodentia: Myomorpha, Hystricomorpha) //Doklady Biol. ... Chernova O.F. Unusual hair structure in Sloths (Edentata: Bradypodidae) // Doklady Biol. ... Chernova O.F. On the inhabitants of mammal hair and skin // Entom. ...

Еще в разделе: (Показать все результаты (>10789) - www.sevin.ru/ )

• Экологический Форум - Фундаментальная Экология: like they may most certainly
• Экологический Форум - Фундаментальная Экология: like they can most certainly
• Экологический Форум - Фундаментальная Экология: when they will likely be sq and

. Please standby and you will be automatically connected to the new location of the unframed Supernova page. Or, click on the link above. If you have questions or problems, please email me at David Bishop dbishop@vhdl.org . Last modified: Mon Aug 27 12:40:15 EDT 2001

Еще в разделе: (Показать все результаты (>98) - www.rochesterastronomy.org/ )

• Bright Supernova Bright Supernova - links

The abstract must not exceed one page. The electronic version must be sent to gertsens@imec.msu.ru . Abstract example . ... Paper example . Для выпуска сборника тезисов просьба выслать до одной страницы текста, предпочтительно набранного в формате Word со следующими параметрами: . Основной текст - Times New Roman Cyr, размер шрифта - 10. Название - Times New Roman Cyr, полужирный, буквы заглавные, размер шрифта - 11. ... Материалы следует выслать по адресу: gertsens@imec.msu.ru ...

Еще в разделе: (Показать все результаты (>37) - hit-conf.imec.msu.ru/ )

... О UNИX . ... ApacheWithModPython . ... Why Use mod_python . ... The sample configurations below are for a wiki instance called mywiki installed in a directory /var/www/moin/mywiki with the main MoinMoin installation installed in python's default site library path. ... Add a Location directive: <Location /mywiki> SetHandler python-program # Add the path of your wiki directory PythonPath "['/var/www/moin/mywiki'] + sys.path" PythonHandler MoinMoin.request.request_modpython::Request.run </Location> . ...

Еще в разделе: (Показать все результаты (>323) - uneex.mithril.cs.msu.su/ )

• HelpOnInstalling/BasicInstallation - UNИX
• HelpOnInstalling/TroubleShooting - UNИX
• HelpOnXmlPages - UNИX

FemtoScan 001 - FAQ . Russian version . ... How to build a histogram for a part of image . ... How to copy and print files seen in Quick View . Quick View Parameters and other options . About Macros . ... Choose the command Parameters in the menu View or in the popup menu, which appears after pressing the right button of the Mouse. ... All the images seen in Quick View . ... QuickView] - Legend view, seen on the images of Quick View , number of images ( Show All Images ) . ...

Еще в разделе: (Показать все результаты (>187) - www.spm.genebee.msu.ru/ )

• FIMIS
• Scanning Probe Microscopy Image Processing Software User's Manual FemtoScan
• List of my publications issued in 2003-

Russian TeX Disk . ... Please, use "Save link as" (right mouse button) for downloading files, otherwise binary files will be corrupted. What is russian TeX disk . ... Some TeX versions and tools are installed/russified and can be started directly from CD; other are only distributives plus additional files for their russification. ... FPTEX . ... Directory russian.add: Generic files (mf-sources, pfb-fonts and hyphen file) for russification of any-TeX-realizations in: . ... file readme: . ...

Еще в разделе: (Показать все результаты (>7) - tex.bog.msu.ru/ )

• http://tex.bog.msu.ru/rustexeo.html

О факультете . ... Социологические школы и олимпиады . ... Вестник МГУ . ... МГУ, д. 1. стр. ... English version . ... Programs for foreign students . ... Contacts Faculty of Sociology was founded on June 6, 1989. ... Hence the faculty offers the best educational programs to meet the needs of international students and requirements of contemporary sociology and employment standards in today?s dynamic and changing world. ... PhD programs The faculty provides studies for bachelor's degree in Sociology. ...

Еще в разделе: (Показать все результаты (>100) - www.socio.msu.ru/ )

... One of the project objectives was to investigate practical efficiency of some modern iterative methods, including multigrid techniques and domain decomposition methods as well as methods for small compressible materials. ... Hence, the project research initiated because of INTAS financial support contributes in setting up modern computational techniques in tire design. ... Research on efficiency of iterative methods was conducted at the department of Mechanics of Composites about ten years ago. ...

Еще в разделе: (Показать все результаты (>4) - composite.msu.ru/ )

Network Working Group RFC # 513 NIC # 16444 Wayne Hathaway AMES-67 30 May 1973 COMMENTS ON THE NEW TELNET SPECIFICATIONS I would like to make the following comments on Protocol Specification (NIC # 15372) and TELNET (NIC 15373). ... In particular, problems arise when a TELNET "synch" is received, and the receiving NCP is required to scan the input looking for "interesting" things. ... The TELNET "synch" would thus be defined as "discard all input up to and including the next DM command." ...

Еще в разделе: (Показать все результаты (>31228) - mirror.msu.net/ )

• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/rfc513.txt
• http://mirror.msu.net/pub/gentoo-portage/sys-kernel/genkernel/genkernel-3.4.45.1.ebuild
• http://mirror.msu.net/pub/gentoo-portage/sys-kernel/genkernel/genkernel-3.4.50.ebuild

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>22) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

English version . department presentation . ... Кафедра . ... The Department of Foreign Literature was found in the Moscow University in 1863 (although, the courses of Western belles-lettres were given at the Philological Department since the late 18th century) and has subsisted till the 1920s when the study of foreign literature was scrapped from the reorganized University structure. ... The Department publishes works in Russian and foreign languages. ... Department of foreign literature. ...

Еще в разделе: (Показать все результаты (>491) - www.philol.msu.ru/ )

• Sample linguistic problems :: МГУ :: Филфак :: ОТиПЛ
• LangueDOC :: Movie

... For the past years I have been working on the problem of synthesis of light curves of close binary systems, consisting of a normal star and a compact object (point object with fixed X-ray luminosity). ... Possible existence of a bright spot on the disk's lateral surface is taken into account. ... The last of then will be published in Gordon and Breach Publishers ( Cherepashchuk A.M., Katysheva N.A., Khruzina T.S., Shugarov S.Yu. ... Cherepashchuk A.M., Katysheva N.A., Khruzina T.S., Shugarov S.Yu. ...

Еще в разделе: (Показать все результаты (>26) - uranus.sai.msu.ru/ )

• Anatol Cherepashchuk
• Igor Antokhin
• Linux on CLEVO 8750

Support ] [ Links to DC resistivity and IP software in WWW ] . ... TRF_2D for Windows - Automated 2D Inversion Program for VES Travers Data. ... The scientists of the laboratory are developing algorithms and computer programs for decision of forward and inverse problems of resistivity and induced polarization methods, which are widely known in Russia and are applied in many countries abroad. ... IE2DL - the set of the programs for resistivity and IP data modeling in 2D inhomogeneous media . ...

Еще в разделе: (Показать все результаты (>83) - geophys.geol.msu.ru/ )

• TRF_2d. Page 4.
• Theory of resistivity sounding
• TRF_2d. Page2

... By default, all columns except the "time" column is operated on, but this can be changed (see -C ). operand If operand can be opened as a file it will be read as an ASCII (or binary, see -bi ) table data file. ... I0 1 Modified Bessel function of A (1st kind, order 0). ... INV 1 1 / A. J0 1 Bessel function of A (1st kind, order 0). J1 1 Bessel function of A (1st kind, order 1). ... K1 1 Modified Bessel function of A (2nd kind, order 1). ... Y0 1 Bessel function of A (2nd kind, order 0). ...

Еще в разделе: (Показать все результаты (>758) - xray.sai.msu.ru/ )

• http://xray.sai.msu.ru/~ivan/gmt/man/grdmath.html
• Colloquium on gamma-ray bursts
• World Wide Web version

... Robert Hermann Brookline, MA (Received November 22, 1999) der to illustrate the obvious progress, one can mention a variety of examples. ... In or- FYI Item "BMS Report on Institutes" As a member of the panel commissioned by the Board on Mathematical Sciences of the National Research Council, I write to correct several inaccuracies in the "For your information" note by Allyn Jackson entitled "BMS Report on Institutes" in the December 1999 issue of the Notices. ...

Еще в разделе: (Показать все результаты (>85) - chaos.phys.msu.ru/ )

... Graduate study . ... Here you can find some information about exams for graduate students. ... 119992 Moscow, GSP-1, Leninskie Gory, MSU, mechanics and mathematics department, OPU, Room 13-14 . ...

Еще в разделе: (Показать все результаты (>147) - new.math.msu.su/ )

• Educational materials | Department: General Problems of Control. Faculty of
• History | Department: General Problems of Control. Faculty of Mechanics and
• Choose language | Department: General Problems of Control. Faculty of Mechanics