The use of the external module Ab_An.dll Ab_An.dll file is an external module for the Gibbs program, and is designed to calculate the activity coefficients of the components of albite- anortite solid solution. ... A non-ideal model of albite-anortite solid solution, proposed in literature [1], is used in this module. ... Preparation of the System file To be able to use the module Ab_An.dll, you need to include a binary solid solution of albite and anortite into the System file, as you create it. ...

Еще в разделе: (Показать все результаты (>76) - www.geol.msu.ru/ )

• http://www.geol.msu.ru/deps/geochems/soft/en/Electrum.doc
• Download Yuri Shvarov's files

... E. Huhlaev, Metamake Tools for Personal Project Preparation in Heterogeneous Network Environment (ID=260), Word doc . ... O. Kodolova, Experience with OO Database for CMS Events Distributed Between Two Sites (ID=294), PDF file . ... A. Nikitin, The GA Based Approach to Optimization of Parallel Calculations in Large Physics Problems (ID=220), Word doc . ... J. Seixas, Neural Particle Discrimination for Triggering Interesting Physics Channels Using Calorimetry Data (ID=311), PDF file . ...

Еще в разделе: (Показать все результаты (>76) - acat02.sinp.msu.ru/ )

• http://acat02.sinp.msu.ru/24june.html
• http://acat02.sinp.msu.ru/25june.html

... О UNИX . ... HelpOnTables . ... Table Markup . ... General table layout and HTML like options . ... Line breaks within cells . ... Bulleted lists and other complex content within cells To create a table, start & end a new line using the table marker; two 'pipe' characters " || ... top left cell || top right cell || || bottom left cell || bottom right cell || ... Just use CSS-formatted styles and it will be inlined in the generated HTML tag. <style="..."> will put that style info into cell (td) html ...

Еще в разделе: (Показать все результаты (>1246) - uneex.mithril.cs.msu.su/ )

• Index of /static/GimpDoc_EnRu/images/dialogs/examples
• HelpOnMoinWikiSyntax - UNИX
• HelpOnProcessingInstructions - UNИX

To get an overview of section 1 (one) of the manual: man 1 intro . ... This displays a one line synopsis of each command that has this keyword in its description. To search the online manual for a command with the phrase "copy files": man -k 'copy files' . ... To check what a command does: whatis more more, page (1) - browse or page through a text file . ... To display the manual page for the cp (copy files) command: man cp . ... To print the manual page for the man command: man -t man . ...

Еще в разделе: (Показать все результаты (>584) - comet.sai.msu.ru/ )

• Getting a description of each command
• Checking the description of a command
• Execute a command without creating a new process

... Algorithm & . Format requirements . ... SDPsite is a tool for identification of protein active and other functional sites, based on spatial clustering of SDPs (specificity-determining positions, described here ) with CPs (conserved positions). ... Mapping predictied positions onto structure and construction of the best cluster . ... The input data of the algorithm are a multiple protein alignment divided into specificity groups . ... is called statistical significance of the set of k* positions . ...

Еще в разделе: (Показать все результаты (>143) - bioinf.fbb.msu.ru/ )

• User's guide

... rfbr:rest:taskschema ]] . THEP . ... Форматы описания заданий: . ... Формат описания задач . ... Описание задач Значения некоторых параметров описания задачи содержат относительные пути к файлам. ... Версия данной схемы 2. description, строка, опциональный параметр Описание задачи в произвольной форме, для понимания человеком. executable, строка Относительный или абсолютный путь выполняемого файла задачи. ... rfbr/rest/taskschema.1291809812.txt.gz ћ Last modified: 08/122010 15:03 by demichev . ...

Еще в разделе: (Показать все результаты (>15337) - theory.sinp.msu.ru/ )

• fcp:rest:taskschema [THEP]
• rfbr:rest:jobschema [THEP]
• fcp:rest:jobschema [THEP]

Brain Research Group >> Research >> Change-point analysis ... << previous next >> . ... When detection of the change-points in alpha band power was performed as in the previous subsection, more than one change-point per second was obtained in average. ... The hypothesis of the hierarchy of EEG segmental descriptions (Kaplan 1998) (see subsection 7.3.2) is a theoretical reason for introducing the adjustment of the change-point detection probability. ...

Еще в разделе: (Показать все результаты (>69) - brain.bio.msu.ru/ )

• Other prospects of the change-point based analysis
• Nonparametric approaches to the description of EEG piecewise stationary
• Laboratory for Neurophysiology and Neuro-Computer Interfaces (NNCI) (former

... PYTHON _DEPS} dev- python /numpy[${ PYTHON _USEDEP}] ) qt4? ( dev-qt /qtgui:4 dev-qt /qttest:4 opengl ? ( dev-qt /qtopengl:4 ) ) qt5? ( dev-qt /qtgui:5 dev-qt /qttest:5 dev-qt /qtconcurrent:5 opengl ? ( dev-qt /qtopengl:5 ) ) threads? ( dev-cpp/tbb ) tiff? ( media-libs /tiff:0 ) v4l? ( = media-libs /libv4l-0.8.3 ) vtk? ( sci-libs/vtk[rendering] ) webp? ( media-libs /libwebp ) xine? ( ...

Еще в разделе: (Показать все результаты (>48265) - mirror.msu.net/ )

• http://mirror.msu.net/pub/gentoo-portage/media-libs/opencv/opencv-3.1.0-r2.ebuild
• http://mirror.msu.net/pub/gentoo-portage/media-libs/opencv/opencv-2.4.9.ebuild
• http://mirror.msu.net/pub/gentoo-portage/media-libs/opencv/opencv-2.4.12.ebuild

... Double Buffering with Split Collective I/O . ... this macro switches which buffer "x" is pointing to */ #define TOGGLE_PTR(x) (((x)==(buffer1)) ? ... void double_buffer( MPI_File fh, MPI_Datatype buftype, int bufcount) { . ... DOUBLE-BUFFER prolog: * compute buffer1; then initiate writing buffer1 to disk */ compute_buffer(compute_buf_ptr, bufcount, &done); MPI_File_write_all_begin(fh, write_buf_ptr, bufcount, buftype); . ... DOUBLE-BUFFER epilog: * wait for final write to complete. ... Центры . ...

Еще в разделе: (Показать все результаты (>576) - www.parallel.ru/ )

• Examples | PARALLEL.RU - Информационно-аналитический центр по параллельным
• mpif90 | PARALLEL.RU - Информационно-аналитический центр по параллельным
• mpif77 | PARALLEL.RU - Информационно-аналитический центр по параллельным

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>22) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

... Science . ... 3-d International Laser Graduate School "Modern Problems of Laser Physics LGS-2009 " . ... Main Science and education Scientific Laboratories Laboratory of computer simulations in optics . ... Dergachev Aleksandr Aleksandrovich engineer, Ph.D. Dormidonov Aleksandr Evgen'evich Ph.D. Kandidov Valeriy Petrovich professor, Doctor of science . ... Femtosecond Nonlinear Optics of High Power Laser Radiation . Femtosecond TW Laser Pulse Filamentation in Gases and Condensed Media . ...

Еще в разделе: (Показать все результаты (>157) - ofvp.phys.msu.ru/ )

Trac Reports = [[TracGuideToc]] The Trac reports module provides a simple, yet powerful reporting facility to present information about tickets in the Trac database. ... You can already completely replace the reports module by the query module simply by disabling the former in [wiki:TracIni trac.ini]:'' {{{ [components] trac.ticket.report.* = disabled }}} ''This will make the query module the default handler for the тАЬView TicketsтАЭ navigation item. ...

Еще в разделе: (Показать все результаты (>3514) - kodomo.cmm.msu.ru/ )

• http://kodomo.cmm.msu.su/trac/tanchiki/wiki/TracReports?format=txt
• TracReports (diff) вАУ Tanchiki
• TracReports тАУ Tanchiki

The files containing information about Affymetrix microarrays were downloaded from the official Affymetrix site. ... Probe sequences were mapped to the genome using Blat. ... The hits found "probe alignment regions" were . ... We annotated each probe alignment region using the mRNA and EST alignments provided by UCSC, considering only . ... The textual part of the interface consists of probe information section, probe alignment section and transcription state . ... Each gene and each probe alignment . ...

Еще в разделе: (Показать все результаты (>7255) - mouse.belozersky.msu.ru/ )

• Geometrical core
• wLake algorithm description

... Parsimony method . ... It is based on the following principle: the ancestral sequences (posed in nodes of a phylogenetic tree) should be such that the minimal required number of character replacements on the branches of the tree is less than for any other choice of sequences. ... If the preliminary character of the node is * , but the output character of its immediate ancestor is some letter (say, X ), and its set of possible characters contains X , then the output character of the node is also X . ...

Еще в разделе: (Показать все результаты (>5700) - monkey.belozersky.msu.ru/ )

• SDPpred
• SDP home page
• About this project

... Phys. A25 (2010) 3933 (arXiv:0908.0457 [hep-ph]) A brief reminder AdS/CFT correspondence ­ the conjectured equivalence between a string theory defined on one space and a CFT without gravity defined on conformal boundary of this space. ... At one imposes certain gauge invariant boundary conditions on the fields. Equation of motion for the scalar field Solution independent of usual 4 space-time coordinates where M is identified with the quark mass matrix and with the condensate. ...

Еще в разделе: (Показать все результаты (>194) - qfthep.sinp.msu.ru/ )

• http://qfthep.sinp.msu.ru/talks2011/sochi_melnikov.pdf
• http://qfthep.sinp.msu.ru/talks2011/asymbrane_QFTHEP11.pdf
• http://qfthep.sinp.msu.ru/talks/pr_Gamzova.pdf

... public class ExtensionFileFilter . ... A convenience implementation of FileFilter that filters out all files except for those type extensions that it knows about. ... Extension - create a new filter that filerts out all files but gif and jpg image files: JFileChooser chooser = new JFileChooser(); ExtensionFileFilter filter = new ExtensionFileFilter( new String{"gif", "jpg"}, "JPEG GIF Images") chooser.addChoosableFileFilter(filter); chooser.showOpenDialog(this); . ... private java.lang.String . ...

Еще в разделе: (Показать все результаты (>103) - angel.cs.msu.su/ )

• : Package ucar.multiarray
• : Package ucar.netcdf
• Appendix B File Format Specification

... Course "Computer Physics" for 1st and 2nd year students of Physics . ... The audience is 1st and 2nd year students of Physics. ... It consists of a short lecture course, seminars, and a large number of computer labs. ... 1985-1994 : Lectured a specialized course on "Computer Physics"for the 3rd year students of Physics, Department of Physics, and attendees of the continuing education department, International Laser Center of Moscow State University. ... 2016 Quantum Information Laboratory. ...

Еще в разделе: (Показать все результаты (>89) - qilab.phys.msu.ru/ )

... Abstract Description of the whole sorption preconcentration step was proposed based on a system of equations comprising equations of mass balance, external diffusion mass transfer and equilibrium distribution of analyte. ... Moscow University Chemistry Bulletin . 2009, Vol. ... 4, P. 238 . Copyright (C) Chemistry Dept., Moscow State University, 2002 . ... Copyright (C) Chemisty Department of Moscow State University . ... Web-design: Copyright (C) MIG and VVM . ...

Еще в разделе: (Показать все результаты (>1578) - chem.msu.ru/ )

• Moscow University Chemistry Bulletin Vol. 42, No. 2, P. 121 (2001)
• PC Crystal Chemistry Analysis of Organic Crystal Structures
• Exciplexes on INTERNET

... Description . Catalog . ... In the Catalog, we publish equatorial (ЮБ 2000 , ЮД 2000 ) and galactic (l,b) coordinates of cluster centers derived as the position of overdensity in 2MASS catalog (Koposov et al. ... Distances, color-excesses and ages are the mean-square values calculated using all available evaluations from different color-magnitude diagrams. ... There are individual pages for every cluster where all available plots and parameters are published. ... 2002). ...

Еще в разделе: (Показать все результаты (>222) - ocl.sai.msu.ru/ )

• SAI OCL Catalog Virtual Observatory

... Publications . ... Number of publications 0 . ... Publication type . ... Borisov A. V. , Kazakov A. O. , Sataev I. R. The Reversal and Chaotic Attractor in the Nonholonomic Model of Chaplygin?s Top . Regular and Chaotic Dynamics, 2014, vol. 19, no. 6, pp. ... Borisov A. V., Kazakov A. O., Sataev I. R., Regular and Chaotic Attractors in the Nonholonomic Model of Chapygin's ball, Russian Journal of Nonlinear Dynamics, 2014, vol. 10, no. 3, pp. ... Institute of Computer Science Izhevsk, 2005 - 2016 . ...

Еще в разделе: (Показать все результаты (>223) - ics.org.ru/ )

• Institute of Computer Sciences - Staff - Pivovarova Elena Nikolaevna