... General Information . ... For physics faculty . ... For natural faculties . ... Institute of General Physics RAN (Moscow) . ... Kazan State University (Kazan) . ... the science laboratories and group of the department have broad contacts with science and educational institutions around the globe: . ... Institute of Solid State Physics, Tokyo University . ... Institute of Solid State Physics, Vienna University of Technology . ... Institute of General Physics, Dresden Technical University, Germany . ...

Еще в разделе: (Показать все результаты (>33) - ferro.phys.msu.ru/ )

• Physics Department of Moscow State University

... Department of Mathematics, . Faculty of Physics, MSU . ... Mathematical analysis 2 . ... Department seminar . ... Vladimir Andreev , Moscow State University, Russia . ... Vera Beloshapko , Moscow State University, Russia . Alexander Belov , Moscow State University, Russia . Inna Belukhina , Moscow State University, Russia . Igor Blatov , Povolzhsky State University of Telecommunications and Informatics, Russia . ... Department of Mathematics, Faculty of Physics, Lomonosov MSU 2014-2016 ...

Еще в разделе: (Показать все результаты (>10) - math.phys.msu.ru/ )

A.N. Belozersky Institute . Bioinformatics Portal . ... Russian EMBnet Node . ... AliBee - Multiple alignment Release 2.0 . ... Grants information . ... Our Institute is a scientific department of Moscow State University. ... Address: Belozersky Institute,Moscow State University,Leninskie Gory 1,Bldg. ... Information about our activities and EMBnet resources around the World is available here . Information about our educational activities with kids, children and teenagers is available here . ...

Еще в разделе: (Показать все результаты (>245) - www.genebee.msu.ru/ )

• GeneBee service
• Picornaviruses: discovering big in small
• Databases

... Conferences . ... International Scientific Conference "Probability Theory and its Applications" on Occasion of the 85-th Birthday of Yu.V.Prokhorov is organized by the Steklov Mathematical Institute , Faculty of Computational Mathematics and Cybernetics of Moscow State University , and Institute for Informatics Problems of Russian Academy of Sciences from 12 to 14 of February, 2015. ... CMC MSU students at GSIS Summer School, Tohoku University, Japan . ... CMC MSU тИТ GSIS Tohoku IT Joint Seminar . ...

Еще в разделе: (Показать все результаты (>259) - en.cs.msu.ru/ )

• Department of Functional Analysis and its Applications | CMC MSU
• Department of Functional Analysis and its Applications
• Laboratory of Mathematical Problems of Computer Security | CMC MSU

... Department . ... Department of the Automation for Scientific Research (ASR) was founded in 1988 on the basis of research and teaching group of the Mathematical Physics Department (former Department of Computational Mathematics). ... Under his guidance the department performs wide spectrum of research in the field of computer simulation of complex systems and processes. ... 2008?2016 ASR Department , CMC Faculty , Lomonosov MSU . ...

Еще в разделе: (Показать все результаты (>21) - ani.cmc.msu.ru/ )

• The ASR Department at the CMC Faculty of Lomonosov MSU
• Courses | Department of the Automation for Scientific Research CMC MSU
• Department of the Automation for Scientific Research CMC MSU | Computational

... G. A Leikin, A. N. Sanovich. Sternberg Astronomical Institute, Moscow 119899, Russia. Brown University - Vernadsky Institute Microsymposium 34, October 8-9, 2001, Moscow, Russia . ... G. A. Leikin and A. N. Sanovich, Sternberg State Astronomical Institute, Moscow State University, . ... Brown University - Vernadsky Institute Microsymposium 38, October 27-29, 2003, Moscow, Russia . ... Sternberg State Astronomical Institute, Moscow, State University, 119992, Moscow, Universitetskij prosp. ...

Еще в разделе: (Показать все результаты (>146) - selena.sai.msu.ru/ )

• Vladislav V. Shevchenko
• Санович А.Н.

... Boris A. Grishanin is an Associate Professor in the Department of Physics, M.V.Lomonosov Moscow State University (MSU). He received his M.S. and Ph.D. degrees from MSU in 1963 and 1968, respectively (both in Physics). ... B. A.Grishanin's current research interests are in the field of quantum theory of open systems, laser physics, molecular dynamics of photoexcited molecules, problems of quantum information and quantum computing. ... Information theory . ... 2016 Quantum Information Laboratory. ...

Еще в разделе: (Показать все результаты (>73) - qilab.phys.msu.ru/ )

. [ Go back to Comet WWW site ] . Andrew A. Martis . martis @ sai.msu.ru .

Еще в разделе: (Показать все результаты (>133) - comet.sai.msu.ru/ )

• Rudnitskij Georgij M. Home Page
• Crimean Laboratory of Sternberg Astronomical Institute (SAI)

. Next: Abstract . On the problem of Super Ratio in Astrophysics . V.M. Lipunov . Sternberg Astronomical Institute, . Universitetskij pr., 13, 119899, Moscow V-234, Russia . E-mail: lipunov@sai.msu.ru . Abstract . Fermi's Paradox . Simple Universe . Tsiolkovskii's Paradox . Scientifically discovered God . Endlessly Complicated World . References . About this document ... Lipunov V.M. Sun May 3 16:35:20 MSD 1998

Еще в разделе: (Показать все результаты (>626) - xray.sai.msu.ru/ )

• PROBLEMS OF THEORETICAL COSMOLOGY - UISS2000
• Welcome to X-Ray
• Be/X-ray binaries and candidates

Head of sector, acting head of the Computational Geophysics Division of the M.V. Keldysh Institute for Applied Mathematics, RAS. ... Finished the Electrodynamics and Quantum Theory Department of Faculty of Physics, MSU in 1962. ... Ill-posed problems, stochastic processes, theory of approximation. Mechanics and physics of multi-phase media, phenomena in porous media, difference schemes for some classes of mathematical physics problems (filtration, elasticity theory). ...

Еще в разделе: (Показать все результаты (>6) - compmech.math.msu.su/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>18) - mouse.genebee.msu.ru/ )

... Data . ... Solar energetic particles . ... Projects . ... Neutron flux variations (RU) . ... InterHelio-Zond . ... INTERHELIO-Zond PROJECT . ... INTERHELIO-Zond project is being developed within the framework of the Federal Space Program of the Russian Federation . It is aimed at the research of the Sun from close distances including inner heliosphere and solution of the problems of solar corona heating, acceleration of the solar wind, origin of the solar flares and coronal mass ejections. ...

Еще в разделе: (Показать все результаты (>70) - smdc.sinp.msu.ru/ )

• Space monitoring data center
• About - Space monitoring data center

The Department of Talented Youth Affairs and Professional Orientation . ... Newer posts . Posted on 01.12.2015 by editor . In 2015, as part of the National Strategy of actions in interests of children the Interdisciplinary Research and Education Center for Childhood Fundamental Studies was created in the Human Research Institute of Moscow State University. ... Posted in News , Без рубрики | ... 2016 - The Department of Talented Youth Affairs and Professional Orientation ...

Еще в разделе: (Показать все результаты (>102) - talant.msu.ru/ )

• Roundtable meeting ?Problems of continuous psychological and educational
• All-army olimpiad | The Department of Talented Youth Affairs and Professional

... 1967-1972: Undergraduate: M.V. Lomonosov Moscow State University, Department ofТ Mechanics and Mathematics. ... 1980-1987: The Deputy Dean for science and research, Department ofТ Mechanics and Mathematics, M.V. Lomonosov Moscow State University . ... 1997-2001: The Deputy Minister ofТ the Education ofТ the Russian Federation . ... since 2003: Head ofТ Department ofТ Mechanics, Steklov Mathematical Institute, Russian Academy ofТ Sciences . ... Institute of Computer Science Izhevsk, 2005 - 2016 . ...

Еще в разделе: (Показать все результаты (>223) - ics.org.ru/ )

• Institute of Computer Sciences - Staff - Borisov Alexey V
• Institute of Computer Sciences - Publications
• Institute of Computer Sciences - Staff - Erdakova Nadezhda Nikolaevna

In Russian . ... Sections and Topics . ... Russian Visa . ... Moscow, June 27 - July 2, 2005 . theoretical problems and novel methods in phenomenological and statistical thermodynamics, thermodynamics of irreversible processes . ... teaching of chemical thermodynamics . ... Gorbenko , Moscow State University, Chemistry Department . ... Bulat R. Churagulov , Moscow State University, Chemistry Department . ... Vladimir A. Durov , Moscow State University, Chemistry Department . ...

Еще в разделе: (Показать все результаты (>1561) - chem.msu.ru/ )

• Center of Scientific Information of the Chemistry Department of Moscow State
• Портал фундаментального химического образования России. Наука. Образование.
• Entrance Examinations - Main Round

Database on charge transfer in DNA V.D.Lakhno, E.V.Sobolev, N.S.Fialko, V.V.Baryshnikov, L.A.Kirzhemanov (Pushchino, Moscow Region) The Institute of Mathematical Problems of Biology, RAS has been engaged in the studies on modeling charge transfer in DNA for several years. ... 10, 2002, .188-195 database could be used to diagnose genetic diseases, to calculate elements of circuits in DNA-based nanoelectronic devices, etc. ... Web- SSH-. ... User Mode Linux) SSL (Secure Socket Layer) SSH (Secure Shell). ...

Еще в разделе: (Показать все результаты (>310) - www.mce.biophys.msu.ru/ )

• http://www.mce.biophys.msu.ru/archive/doc62923/doc.pdf
• http://www.mce.biophys.msu.ru/archive/doc151254/eng.pdf
• http://www.mce.biophys.msu.ru/archive/doc151660/eng.pdf

... Previous message: [RU-NGI] Problem with lcg58.sinp.msu.ru . Next message: [RU-NGI] Problem with lcg58.sinp.msu.ru . ... Information from ESET NOD32 Antivirus , version of virus signature database 7042 ( 20120410 ) __________ The message was checked by ESET NOD32 Antivirus . http://www.esetnod32.ru/.ml __________ Information from ESET NOD32 Antivirus , version of virus signature database 7042 ( 20120410 ) __________ The ...

Еще в разделе: (Показать все результаты (>1727) - theory.sinp.msu.ru/ )

• M.Z. Iofa Curriculum vitae.
• [RU-NGI] File transfer problem
• History and personal contributions

As it was already mentioned, the idea behind File Juggler is rather simple: using CGI scripts as processing tools and WWW browser as user interface, display the structure and content of typical anonymous FTP server in a convenient, easily navigated form. ... My P5-133 spends about 0.025 ms on one file when doing linear search with simple criterion (690 ms for 27,000 files, search for substring among file names/descriptions with 70 hits). ... Let's now look whether we can handle 1,000,000 files. ...

Еще в разделе: (Показать все результаты (>1908) - crydee.sai.msu.ru/ )

• Heliophysics, Internal structure and seismology
• V.A.Baturin - Home Page at Sternberg Astronomy Institute, MSU
• ASACafedra

... Problems of search for collisions of cryptographic hash functions of the MD family as variants of Boolean satisfiability problem" . Bogachkova I.A., Zaikin O.S., Kochemazov S.E., Otpushchennikov I.V., Semenov A.A., and Khamisov O.O. An implementation of the differential attacks on cryptographic hash functions MD4 (Message Digest 4) and MD5 (Message Digest 5) by reducing the problems of search for collisions of these hash functions to the Boolean satisfiability problem (SAT) is considered. ...

Еще в разделе: (Показать все результаты (>591) - num-meth.srcc.msu.ru/ )

• "Updatable XML-views over relational databases"
• Gradient methods for solving inverse gravimetry and magnetometry problems on
• Adaptive unstructured mesh generation methods for hydrogeological problems

... Destructive effects of many tsunamis are confined to areas within about one hour of the initial propagation time (that is, within a few hundred km of their source). ... Two international tsunami workshops have recently been held in Russia ( "Tsunami Mitigation and Risk Assessment," Petropavlovsk-Kamchatskiy,1996 , and "Tsunami Risk Assessment Beyond 2000: Theory, Practice and Plans," Moscow, 2000). ... The final product of the workshop will be recommendations on local tsunami warning and mitigation....

Еще в разделе: (Показать все результаты (>33) - seac47-2.phys.msu.ru/ )

• LOCAL TSUNAMI WARNING AND MITIGATION